Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10410

FASTA Sequence
Unigene ID: UN10410Length: 632  SNP
GGGACTCATCACTACACACTTCTCATTTTACAAACAATCAATAGCCCCTAAAACAAAGAAAAATGGCTGGTCTAATGAAGTTGGCA
TGCTTGGTCTTGGCCTGCATGATTGTGGCCGGTCCAATCACAACGAACGCGGCTCTGAGCTGTGGAACCGTTAACAGTAACTTGGC
AGCATGCATTGGCTACTTGACCCAAAATGCGCCCCTCGCCAGAGGTTGCTGCACCGGCGTTACTAATCTGAACAACATGGCCCGTA
CAACCCCCGACCGTCAGCAAGCTTGTCGTTGCCTTGTAGGAGCCGCTAACTCCTTCCCTAGTCTAAACGCTGCCCGTGCTGCTGGA
CTTCCTAAGGCATGTGGAGTCAATATTCCTTACAAAATCAGCAAAAGCACCAACTGCAACACCGTTAGATGAGCGGCGACCGGATG
AAGAAACTCAAGCGGACGTACGAATCTAATATAATGTATGAGAGAGTACTAAATAAAATGTTTGAATGGTTGTTTTTCTGGTGTTC
TAAAATTTCATGTTTTCTCTTCTGTTGTGTCGTTCTTTTACTTTGGTCGTATGTACTATTTTCGTAGTCCACGTACGTTATATGAA
GTTTCAGATCCAGGGTTTGCGTTATTCTCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAT40130 lipid transfer protein [Brassica rapa subsp. pekinensis]5904e-059
Q42642 RecName: Full=Non-specific lipid-transfer protein B; Short=LTP B; AltName: Full=Wax-associated protein 9B; Flags: Precursor5781e-057
Q42614 RecName: Full=Non-specific lipid-transfer protein 1; Short=LTP 1; Flags: Precursor5752e-057
Q42615 RecName: Full=Non-specific lipid-transfer protein 2; Short=LTP 2; Flags: Precursor5708e-057
Q42616 RecName: Full=Non-specific lipid-transfer protein 3; Short=LTP 3; Flags: Precursor5332e-052

Swiss-Prot top hits (Blast detail)Scoree value
Q42642 Non-specific lipid-transfer protein B5785e-059
Q42614 Non-specific lipid-transfer protein 15751e-058
Q42615 Non-specific lipid-transfer protein 25704e-058
Q42616 Non-specific lipid-transfer protein 35338e-054
Q43304 Non-specific lipid-transfer protein D5078e-051

TrEMBL top hits (Blast detail)Scoree value
Q6IWH2 Non-specific lipid-transfer protein5903e-059
A2ID77 Non-specific lipid-transfer protein5241e-051
Q9SMM1 Non-specific lipid-transfer protein5178e-051
O82582 Non-specific lipid-transfer protein4764e-046
B4YYA8 Non-specific lipid-transfer protein4756e-046

Arabidopsis top hits (Blast detail)Scoree value
AT2G38530.1 LTP2 (LIPID TRANSFER PROTEIN 2); lipid binding4835e-049
AT2G38540.1 LP1; calmodulin binding4656e-047
AT3G51600.1 LTP5 (Lipid transfer protein 5); lipid transporter3501e-033
AT2G15050.3 LTP; lipid binding3455e-033
AT2G15050.1 LTP; lipid binding3357e-032

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
114  15%
 
67  27%
 
78  31%
 
103  12%
 
81  4%
 
122  8%
 
191  4%

Unigene MembersMember information