Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10434

FASTA Sequence
Unigene ID: UN10434Length: 1828  SNP
GAGCCGTACTGTAAAGCGTATTGCTGATGTTTCAAAGCTCAGGATCTATCAATTCCCGCAGGATGCTGGTCCTATGGCACATCCTG
TTCGCCCACATTCATACATCAAGATGGACAACTTCTACACAGTGACGGTTTATGAAAAGGGAGCTGAGGTTGTGAGGATGTACAAA
ACTCTACTAGGAAGTGAGGGTTTCCGAAAGGGTATTGATCTTTATTTTCAAAGACATGATGAGCAAGCTGTGACCTGTGAAGACTT
CTTTGCTGCTATGCGTGATGCAAACAATGCAGATTTTGCTAATTTCTTGCAATGGTACTCTCAAGCTGGGACGCCAGTCGTCAAAG
TGGCATCTTCTTACAATGCTGAAGCTCGTACCTTCTCTTTGAAATTCAGTCAGGAGATACCCCCGACTCCGGGCCAGCCAACAAAA
GAACCAACGTTTATTCCAGTGGTTGTTGGTCTTCTGGACTCGAGTGGAAAAGACATTACACTTTCCTCTGTTTACCATGATGGTAC
ACTTCAGACCATTTCAAGCAGCAGCACAATCCTTCGAGTGACTAAGAAAGAAGAAGAGTTTGTGTTCTCTGATATATCAGAAAAAC
CTGTGCCGTCTCTGTTTAGAGGATTCAGTGCCCCAGTTCGTGTTGAGACTGATCTCTCTGATGATGATCTGTTCTTCCTCCTAGCC
CATGATTCAGATGAATTCAATCGGTGGGAGGCAGGTCAAGTTCTGGCAAGGAAGCTCATGCTGAACTTAGTTTCTGATTTCCAACA
AAACAAACCATTGGTTCTAAACCCAAAATTCATTCAGGGTCTCGGAAGCGTGCTTTCTGACTCGAGCTTGGACAAGGAATTTATCG
CCAAGGCAATAACATTGCCTGGGGAGGGAGAGATTATGGACATGATGGCCGTGGCGGATCCTGATGCTGTTCATGCTGTTAGAAAG
TTTGTTAGAAAGCAGCTTGCATCTGAACTTAAAACTGAGCTTCTAAAGATAGTTGATAACAATAGGAGCACAGAGGCTTATGTATT
TGACCACCCAAACATGGCTAGGCGTGCTTTGAAGAACACGGCTCTAGCTTATCTTGCATCTCTTGAGGATCCAGCATACGTGGAAC
TTGCATTGGGTGAATACAAGTCGGCCACCAATTTGACAGACCAAATTGCTGCTTTGGCAGCTCTTGCACAAAAGCCGGGTAAAACC
CGTGACGAGGTTCTTGCTGACTTCTATAACAAGTGGCAGGGCGATTACTTGGTCGTTAATAAATGGTTCCTCCTTCAAGCATCCTC
CGACATTCCCGGCAATGTGGAGAATGTCAAGAAGCTTTTGGATCACCCAGCTTTTGATCTGCGCAATCCAAACAAGGTTTACTCGC
TCATTGGAGGGTTCTGCGGTTCGCCAGTGAATTTCCATGCAAAAGATGGATCAGGTTACAAGTTCTTGGGTGACATTGTTGTCCAG
TTAGACAAAATCAATCCTCAGGTTGCTTCTCGTATGGTATCTGCGTTTTCGAGGTGGAAGCGCTACGATGAAACCCGACAAGCTCT
GGCCAAGGCACAGTTGGAGATGATAATGTCAGCTAATGGGTTATCTGAAAATGTATTTGAGATTGCCTCTAAGAGCTTGGCTACTT
GAGAGACCACATCAAGAATCAATTCTACTCGTTGCTCCGGATTATCATGTTATGAGCTTTTTACATTCAACGCATGCACTTTTATA
ATAAACTGATCCTGAACGTCACATGTTTTTCTTTTTATGTTATGAACTTTGTCTCCAACGAAATGATGTTTTTCTTTTATATCAAG
TTGAAAGAATGAACATTCACCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAN72085 putative aminopeptidase [Arabidopsis thaliana]26621e-298
XP_002886386 hypothetical protein ARALYDRAFT_893061 [Arabidopsis lyrata subsp. lyrata]25751e-288
AAG52429 putative aminopeptidase; 4537-10989 [Arabidopsis thaliana]25616e-287
G96662 probable aminopeptidase F24D7.4 [imported] - Arabidopsis thaliana25591e-286
NP_001185303 Peptidase M1 family protein [Arabidopsis thaliana]24291e-271

Swiss-Prot top hits (Blast detail)Scoree value
P45274 Aminopeptidase N10381e-111
O96935 M1 family aminopeptidase7565e-079
P04825 Aminopeptidase N6535e-067
P37893 Aminopeptidase N5532e-055
Q974N6 Probable aminopeptidase 21364e-007

TrEMBL top hits (Blast detail)Scoree value
Q8H0S9 At1g6377026628e-299
Q9CAE1 Putative aminopeptidase; 4537-1098925614e-287
B9RCE0 Aminopeptidase, putative23706e-265
B9GKF8 Predicted protein23581e-263
B3H621 Uncharacterized protein At1g63770.223349e-261

Arabidopsis top hits (Blast detail)Scoree value
AT1G63770.3 peptidase M1 family protein24115e-272
AT1G63770.4 peptidase M1 family protein24115e-272
AT1G63770.2 peptidase M1 family protein23524e-265
AT1G63770.1 peptidase M1 family protein21401e-240

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
211  4%
 
114  16%
 
98  32%
 
85  20%
 
102  8%
 
61  4%
 
73  12%
 
121  4%

Unigene MembersMember information