Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10443

FASTA Sequence
Unigene ID: UN10443Length: 1375  SNP
GGTGAGTGCCCATATATGCACCACTCCCTTGAGATAACCAAGGGACACAACATAAACCCAATCTCCACACACTCACTCACTCACTC
AGACAAAAGAGAAACAAATGGCGAAATCTCCGGAGACAGAGCATCCGAACAAAGCCTTTGGTTGGGCTGCCAAAGACAAATCTGGT
CTACTCTCTCCTTTCCATTTCTCCAGAAGAGACAATGGTGACAATGATGTGACAGTGAAAATCTTGTATTGTGGAGTGTGCCACAC
TGATTTGCATACCATCAAAAACGACTGGGGTTTCTCCTATTATCCTGTCGTTCCAGGGCATGAAATAGTTGGAATCGCTACAAAAG
TTGGCAAAAACGTGACTAAATTCAGAGAAGGAGACCGTGTAGGAGTAGGAGTGATCACTGGTTCTTGCCAATCTTGCGAATCTTGT
GACCAAGATCTTGAAAACTACTGTCCCCAAATGTCTTTCACCTACAACTCCATTGGATCCGATGGAACCAAGACATACGGTGGATA
TTCGGAGTCCATTGTGGTCGACCAACGGTTTGTTTTACAGTTTCCCGAGGGATTACCTAGCGATTCTGGTGCGCCTTTGCTGTGTG
CTGGAATCACTGTGTATAGTCCAATGAAGTACTATGGTATGACCGAGCCAGGGAAGCATTTGGGTGTGGCTGGACTTGGTGGGCTT
GGTCATGTTGCTGTCAAGATTGGTAAAGCTTTTGGTTTGAAAGTTACTGTGATTAGTTCTTCTCCTAATAAAGAAGATGAAGCCAT
TAATCGTCTTGGTGCTGATTCGTTTCTTGTCTCATCTGATCCTCAGAAGATGAAGGCTGCAATAGGAACAATGGACTACATTATCG
ATACCGTTTCAGCAGTACATGCTCTGTTTCCATTACTTGGTTTACTCAAAGTCAATGGAAAGCTAGTCACTTTAGGCTTACCTGAG
AAGCCTCTTGAGCTACCAATCTTCCCTCTTGTTCTCGGAAGGAAAATGGTGGGAGGAAGTGACATTGGAGGAATGAAGGAGACACA
GGAGATGCTTGAGTTCTGCGCTAAGCATAACATAACGGCAGATATTGAGCTGATCAAGATGGATGAGATTAACACTGCAATGGAGA
GGCTTGCTAAGGCTGATGTTAGGTACAGGTTCGTGATCGACGTGGCTAACTCCTTGAGCCCTCCATGACTTAGCCGAATCTAAGAG
TAGACCATGGAGGAATATGTATCTCGTGCTTCTGTTGTGTTCGTGTTATCTTTGTTTTCTACTATTTATGTTTTAGTGAACTGGTT
TCTTCTGAAACAAGTCACCTTAAGTTGTCAGAGAACTTCTCTCTGTTTTTCTTTTCATGATATAATAAGTCTTTCTGATTAGAGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_195643 putative cinnamyl alcohol dehydrogenase 9 [Arabidopsis thaliana]17765e-196
AAM64913 cinnamyl-alcohol dehydrogenase CAD1 [Arabidopsis thaliana]17712e-195
AAA99511 cinnamyl-alcohol dehydrogenase [Arabidopsis thaliana]17702e-195
XP_002866841 hypothetical protein ARALYDRAFT_912392 [Arabidopsis lyrata subsp. lyrata]17684e-195
AAA74746 cinnamyl-alcohol dehydrogenase [Arabidopsis thaliana]17586e-194

Swiss-Prot top hits (Blast detail)Scoree value
P42734 Probable cinnamyl alcohol dehydrogenase 917762e-197
O82515 Probable mannitol dehydrogenase15413e-170
Q9ZRF1 Probable mannitol dehydrogenase12994e-142
P93257 Probable mannitol dehydrogenase12923e-141
Q2KNL6 Geraniol dehydrogenase 112546e-137

TrEMBL top hits (Blast detail)Scoree value
C1IC54 Cinnamyl alcohol dehydrogenase15972e-175
B9GGU3 Cinnamyl alcohol dehydrogenase-like protein15927e-175
A9PDU7 Putative uncharacterized protein15919e-175
B9SVQ2 Alcohol dehydrogenase, putative15702e-172
Q8L7U8 Putative sinapyl alcohol dehydrogenase15632e-171

Arabidopsis top hits (Blast detail)Scoree value
AT4G39330.1 CAD9 (CINNAMYL ALCOHOL DEHYDROGENASE 9); binding / catalytic/ oxidoreductase/ zinc ion binding17771e-198
AT2G21730.1 CAD2 (CINNAMYL ALCOHOL DEHYDROGENASE HOMOLOG 2); binding / catalytic/ oxidoreductase/ zinc ion binding15101e-167
AT2G21890.1 CAD3 (CINNAMYL ALCOHOL DEHYDROGENASE HOMOLOG 3); binding / catalytic/ oxidoreductase/ zinc ion binding15082e-167
AT4G39330.2 CAD9 (CINNAMYL ALCOHOL DEHYDROGENASE 9); binding / catalytic/ oxidoreductase/ zinc ion binding14841e-164
AT4G37990.1 ELI3-2 (ELICITOR-ACTIVATED GENE 3-2); aryl-alcohol dehydrogenase/ mannitol dehydrogenase12412e-136

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
117  25%
 
63  11%
 
103  11%
 
125  18%
 
85  18%
 
93  11%
 
72  7%

Unigene MembersMember information