Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10451

FASTA Sequence
Unigene ID: UN10451Length: 1016  SNP
GGAAACACACTCGATCGATCTATCTAATCTTCATCCTCGTGATCATCGTTGAGAAAGATGGCCAGAAAGTTCTTCGTCGGAGGCAA
CTGGAAATGCAACGGAACTGGTGAGGAGGTGAAGAAGATTGTCAATACTCTTAACGAAGCTCAAGTTCCTTCCCAGGATCTCGTTG
AGGTTGTCGTTAGCCCTCCATATGTGTTCCTTCCTCTGGTTAAGAGCATATTGAGGCCTGACTTCCATGTTGCGGCACAAAACTGC
TGGGTCAAGAAAGGAGGTGCCTTCACTGGTGAAGTTAGTGCTGAGATGCTTGTGAACTTGGACATCCCATGGGTTATCCTTGGTCA
CTCTGAAAGGAGAGCACTCCTCAATGAAACAAACGAGTTTGTTGGAGACAAGGTTGCCTATGCTCTTGCTCAAGGTTTGAAAGTGA
TTGCTTGTGTTGGCGAGACTCTTGAGCAGCGGGAGGCTGGGTCGACCATGGATGTTGTGGCTGCCCAGACTAAAGCTATTGCTGAC
CGGGTGTCGAACTGGTCAAATGTTGTCGTAGCCTATGAACCAGTGTGGGCCATTGGAACCGGAAAGGTCGCTAGCCCAGCCCAAGC
TCAAGAAGTACATGATGAGCTGAGGAAATGGCTTGCAAAGAACGTGAGCGCTGATGTCGCTGCTGCAACCCGCATCATTTATGGAG
GATCCGTCAATGGTGGTAACTGCAAGGAGCTAGGTGGTCAGGCCGATGTTGATGGTTTCTTGGTCGGTGGTGCTTCTCTAAAGCCC
GAGTTTATCGACATCATCAAGGCTGCTGAGGTGAAGAAAAGCGCTTAGTGGCTTCACGAAACAATCTCAAATCCTTTTGCTTCTTC
AGTCTCAACTCTGATCGAAAAAATGAATAAGTTGATACAGTGTTATTGTGATACTCTTTTGCTTCAGTTGTATGTTGTCTTGAGGA
GGCAACACACTTTTTCTTGGCCGTTTTGTTTAGCTCTGAAATCACAAAATCTCACCCTTTTCTAATCTTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002876302 predicted protein [Arabidopsis lyrata subsp. lyrata]12593e-136
NP_191104 triosephosphate isomerase [Arabidopsis thaliana]12512e-135
AAA03449 cytosolic triose phosphate isomerase [Arabidopsis thaliana]12468e-135
P48495 RecName: Full=Triosephosphate isomerase, cytosolic; Short=TIM; Short=Triose-phosphate isomerase11795e-127
ABK92459 unknown [Populus trichocarpa]11562e-124

Swiss-Prot top hits (Blast detail)Scoree value
P48491 Triosephosphate isomerase, cytosolic12511e-136
P48495 Triosephosphate isomerase, cytosolic11792e-128
P21820 Triosephosphate isomerase, cytosolic11291e-122
P12863 Triosephosphate isomerase, cytosolic10871e-117
P48494 Triosephosphate isomerase, cytosolic10806e-117

TrEMBL top hits (Blast detail)Scoree value
A9P7V6 Triosephosphate isomerase11562e-124
B9HTI4 Triosephosphate isomerase11562e-124
Q38JI4 Triosephosphate isomerase11552e-124
D1LWT8 Triosephosphate isomerase11533e-124
Q6T379 Triosephosphate isomerase11491e-123

Arabidopsis top hits (Blast detail)Scoree value
AT3G55440.1 TPI (TRIOSEPHOSPHATE ISOMERASE); triose-phosphate isomerase12527e-138
AT2G21170.1 TIM (TRIOSEPHOSPHATE ISOMERASE); catalytic/ triose-phosphate isomerase8054e-086
AT2G21170.2 TIM (TRIOSEPHOSPHATE ISOMERASE); catalytic/ triose-phosphate isomerase7482e-079

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
109  38%
 
117  29%
 
193  13%
 
211  4%
 
182  8%
 
121  4%
 
71  4%

Unigene MembersMember information