Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10528

FASTA Sequence
Unigene ID: UN10528Length: 789  SNP
AGAGGAAAAGGCATAAAATGTGGTAAGATTCTCTCCGTAACCGTCCTCCCATTTTTTCTATAAGACCCCGACCCCAAGACAAAGCA
AGGATTCATCAAAAACAAAATCAAAATCAAACAGAGAGAGAGAAAGAAAGAACAGAGAAAAAATGGCCGCACCAGCAGAATTGATC
CCAGCAGGAGAAGTGATCGCTTGCCACACCGTCGATGACTGGAACAACAAGTTCAAGGCCGCCAAAGAATCCAACAAGCTGATTGT
GATAGACTTCACAGCAACATGGTGCCCACCTTGCCGTTTCATTGCACCCATCTTCGTCGAGTTGGCTAAGAAGCACCTTGATGTCG
TTTTCTTCAAGGTCGATGTCGATGAATTGAATTCTGTTGCTAAGGATTTCGAAGTTGAGGCCATGCCGACCTTTGTCTACATGAAG
GGTGAAGAGAAGGTCGACAAGGTGGTCGGTGCTGCGAAAGATGAAATCGTAGCCAAGCTTGAGAAGCACTCTCAAGTTGCTTCGGC
TTGATTTGGTTTATCGTTCTCTTCATAACTATTTACCTAGTAGTGTGTTTGGTGTTTTTTAATAAAAATCCTTTGTTGCGTTATTG
TCACTTTCACTTGAATCATCATCATCTTCCCTTTGTGTTGGTTTGGTGTGGTGCCTACATGCCTTGGGTGTGTGAATAAATGTTTG
CAGACTGTATAACTCGCACGCATCTATGCTAAATTTTCATGTTATTAACTCTTGAGGTTATTGTGTTACGTCAGATTTCAGTTTTA
TGTTTACATGGCTTA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
O64432 RecName: Full=Thioredoxin H-type; Short=Trx-H5682e-056
P68176 RecName: Full=Thioredoxin H-type; Short=Trx-H; AltName: Full=Pollen coat protein5611e-055
AAG35777 thioredoxin-h-like protein 1 [Brassica oleracea var. alboglabra]5395e-053
NP_199112 thioredoxin H3 [Arabidopsis thaliana]4581e-043
XP_002865467 thioredoxin H-type 3 [Arabidopsis lyrata subsp. lyrata]4553e-043

Swiss-Prot top hits (Blast detail)Scoree value
O64432 Thioredoxin H-type5681e-057
P68177 Thioredoxin H-type 15617e-057
P68176 Thioredoxin H-type5617e-057
Q42403 Thioredoxin H34586e-045
Q39241 Thioredoxin H54121e-039

TrEMBL top hits (Blast detail)Scoree value
Q9FQ63 Thioredoxin-h-like protein 1 (Fragment)5394e-053
B9GRI3 Thioredoxin h3745e-034
A9PB87 Putative uncharacterized protein3728e-034
A8HTK0 Thioredoxin h13692e-033
C6SYA2 Putative uncharacterized protein3621e-032

Arabidopsis top hits (Blast detail)Scoree value
AT5G42980.1 ATTRX3 (THIOREDOXIN 3); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor4585e-046
AT1G45145.1 ATTRX5; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor4139e-041
AT1G19730.1 ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor3815e-037
AT3G51030.1 ATTRX1; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor3492e-033
AT3G17880.1 ATTDX (TETRATICOPEPTIDE DOMAIN-CONTAINING THIOREDOXIN); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor / protein binding3019e-028

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1111  35%
 
107  23%
 
211  3%
 
128  26%
 
202  6%
 
181  3%
 
191  3%

Unigene MembersMember information