Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10538

FASTA Sequence
Unigene ID: UN10538Length: 1053  SNP
ACACACCTCAATTCATTCGTTAAAAATAAATAATTTCAAATCGTACTTTCATACAAGAGAAGAATCATAAATCTAGAACCACAACG
ATACAAGCAGAAGCGATAGATATGTGAAAGAATCAAAGGGAAAGGATTGGACATGATTAATACACGTGAAAGGAAAAACCAGAGCT
CTGCCATTGTCTTCTCACTTTTTTTCTCCAAGTTATCCTTTAACTGGACTAAATTTCTCAGATGGAGCAAGTGTAGCCCGGAGGTG
GGTTTTTGCCACAGGTAAGAAGAAGCTGAAGAGCAACTGGAACGTACAGCTTAAGGTTAAGAGCTTTAAGCTTAAGTGTAGTGCAG
AGACAAGCTGCTGCTTCAACTTCAACGAGGCCTTTAAGTATCGGACAGCATTTGTTAACGGCTGGGTCTCCTAACCCTATCTTTAC
TAAACCTCCCAACAAGTCAACACACGCCCCCAACTTCAGCGTGTCTATTGGACATGTCGCCTTCCCAGTGCCTGGTGGGGACTTAT
GGCTACCCGGGGGTGGAGGGCAATCTTTTCCTCCTGAACTAGGAGGGTTTGTCCCTGGAGGAAGAAGAGGACCCACAATCGGCAAC
GGTGGCAGTGGCAATGTGGGTAGCCCTCCAACCGGAGGTATGGGTAACCCTCCAACCGGAGGTATGGGTAGCCCTCCAACCGGAGG
TATGGGTAGCCCTCCAACCGGAGGTATGGGTAGCCCTCCAACCGGAGGAATGGGTAGCCCTCCAACCGGGGGAAGTGGTAGTTCTG
GGACGGTCACGGGAGGTACAGGTAGCTTTGGGACGGTGACTGGAGGAACAGGTAGCTTAGGAACTGTCACCGGAGGAACTGGAAGC
TTAGGTACGGTCACTGGAGGAACAGGTAACTTCGGAACGGTCACCGGGGGTTTAGTGGAGTGTTTTCCACCCTTCCTGGGGTTGCA
GGAGCCACATGAGAAGGATTTTTGAGGAAAGAAGATAATGCAAATGAGAATGAAACAGAGAGAAATAGATGAGAGTTTGGATGACT
TCATGTTAGAAGAGCGGATCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_565348 bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin-like protein [Arabidopsis thaliana]10192e-108
BAJ33620 unnamed protein product [Thellungiella halophila]10155e-108
XP_002885841 hypothetical protein ARALYDRAFT_480276 [Arabidopsis lyrata subsp. lyrata]9969e-106
BAE71274 hypothetical protein [Trifolium pratense]6742e-068
ACJ84260 unknown [Medicago truncatula]6284e-063

Swiss-Prot top hits (Blast detail)Scoree value
Q00451 36.4 kDa proline-rich protein4722e-046
Q9FPQ6 Vegetative cell wall protein gp12365e-019
Q01595 Cortical cell-delineating protein2186e-017
P14009 14 kDa proline-rich protein DC2.152178e-017
Q9T0K5 Leucine-rich repeat extensin-like protein 31882e-013

TrEMBL top hits (Blast detail)Scoree value
Q9SKI0 At2g10940/F15K19.110191e-108
Q2PES8 Putative uncharacterized protein6741e-068
A4Q7K6 Plant lipid transfer/seed storage/trypsin-alpha amylase inhibitor6283e-063
B7FHN1 Putative uncharacterized protein6283e-063
C5Z6N9 Putative uncharacterized protein Sb10g0252105899e-059

Arabidopsis top hits (Blast detail)Scoree value
AT2G10940.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein11658e-128
AT2G10940.2 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein11658e-128
AT3G22142.1 structural constituent of cell wall4963e-050
AT1G62500.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein4642e-046
AT4G12520.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein2697e-024

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
77  33%
 
102  10%
 
64  19%
 
94  19%
 
82  10%
 
121  5%
 
111  5%

Unigene MembersMember information