Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10544

FASTA Sequence
Unigene ID: UN10544Length: 1426 SSRSNP
ATAAATTCGTTTTACCATTTAGCAAAGTAGTGATAAGTACGAACAAATGTGTTTATCAAATACATTTTAATAAGAACAAACACGGC
TTTGATGACATGTCAATTCCTTCTCCATGACAAACAACATAAACTAAATAAAATGCGAGAAAAGAACAAAACCCAGTCCCGACACA
CTTATATATCATGACCCACATTTGTCCGAAGTAGCAGTTTTCATGTGAGCTTAAGAAAAAAAGCAGTTAGTAACAACTTTGAAGAC
GTAAGAGATAAGACACACCTGAAAAATATCAACTACTACTACTACTCCCCTTATCTTTTTCTTTCGTGAAGCTGAGTAGATTTGCC
TACATCTTCTCCACACATAACTTCTTCATCAGGACCATATTTTAATTTACTAATCGGACTTGATACCTCCGTTCTGCTTGTTGCTC
TTCTTGGACGACTCTTTGATCTGCTCAAGAAGCTTCTTTTGGAATCGGTAACCCTTGTCAGTTCCATAAATGTAGTCACAATAAGT
AAAAACTGAAGCGAAGTTGCTGTGGCTTTGTCCTCCAACGTAGTGATGGTAGTCATGGTATTCAGCACCACCATAGAAAGGGATGT
ATTTTGTTGGACTCCATGGAAAATCATATCCACTGTGCGTCTCTATAGCCTCAATTTGCCTTAAAGCTATCCACAACCAAAAGGTT
ATCATGTGACCAGGAGCAATCGCTGGTCCCATAAACGTTGGGATTCCAAGAAGCAACACTTCAGCCCAGTGTGCATAAGGTGCAGC
GTATCCAATAGGAGCTGTGTACTCGTGATGAACGCGATGAATGTTCTCGTATCCCCACTTACTGTGGAAAAATCTATGTACCCAAT
AGTTTGTGTAGTCTTCTATCAAGAAGTAGACGAACAACTGTGGCAGCATCTCTGAAAATGTTGGTAATGGTAAACCAGATCGTATC
CCAATCATCTGAATGGAAGGATAAGAAACGAGTTGTAATGGACCAACGACGAGGATGAACATCTTCATGACGTCTTTGTAACATCC
GAACATGTCGGACAAGGAGTAGTTTACTTTGGGTTGGATCTTGTACCGGTCGAACCACCCAGAAGCGGATCGAGCCAGCTCGACGA
GAACCAGAGGGAGAGGAGCTAGAGAAAAGACGAGGAATAGGAAGAGAATGTTGTGGCAGTAGAGATAGTAGTCGGACTTTGTGGCG
GAGTAATCGAACCAAACTGTCTCCAACCACGTGAGGTTTCTTCCGAGCGCGAAGGAAGCTTCCTCAACCGTTACGTAAGGAATCAT
GATGGTAAAGTTTCTCGGTTTCTCCGGCGGGTTTGCGACGGAGATTTGCTGACGTGGAGATCTGATGATCTGGGGAGGAGAGGTTG
AGAGAGAAGAGAAGAAGAGAGTGCTTGTTTGTTATATAGTTGGCGAATCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002872644 hypothetical protein ARALYDRAFT_911602 [Arabidopsis lyrata subsp. lyrata]15159e-166
NP_192948 sterol-4alpha-methyl oxidase 1-1 [Arabidopsis thaliana]15122e-165
AAM64961 putative C-4 sterol methyl oxidase [Arabidopsis thaliana]15113e-165
AAQ13424 sterol-4-methyl-oxidase [Arabidopsis thaliana]15086e-165
CAB40952 putative C-4 sterol methyl oxidase [Arabidopsis thaliana]14961e-163

Swiss-Prot top hits (Blast detail)Scoree value
Q55D54 Putative C-4 methylsterol oxidase DDB_G02697884885e-048
Q55D52 Putative C-4 methylsterol oxidase DDB_G02709464591e-044
Q9UUH4 C-4 methylsterol oxidase4293e-041
P53045 C-4 methylsterol oxidase4033e-038
O59933 C-4 methylsterol oxidase4016e-038

TrEMBL top hits (Blast detail)Scoree value
Q8L7W5 AT4g12110/F16J13_18015121e-165
Q8LB57 Putative C-4 sterol methyl oxidase15112e-165
Q71V05 Sterol-4-methyl-oxidase15084e-165
Q9SZ76 Putative C-4 sterol methyl oxidase14961e-163
Q1EC69 At4g2275613992e-152

Arabidopsis top hits (Blast detail)Scoree value
AT4G12110.1 SMO1-1 (STEROL-4ALPHA-METHYL OXIDASE 1-1); 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase/ C-4 methylsterol oxidase/ catalytic15135e-168
AT4G22756.1 SMO1-2 (STEROL C4-METHYL OXIDASE 1-2); 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase/ C-4 methylsterol oxidase/ catalytic14007e-155
AT4G22753.1 SMO1-3 (STEROL 4-ALPHA METHYL OXIDASE 1-3); 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase/ catalytic12725e-140
AT1G07420.1 SMO2-1 (STEROL 4-ALPHA-METHYL-OXIDASE 2-1); 4-alpha-methyl-delta7-sterol-4alpha-methyl oxidase/ C-4 methylsterol oxidase5952e-061
AT2G29390.2 SMO2-2 (STEROL 4-ALPHA-METHYL-OXIDASE 2-2); 4-alpha-methyl-delta7-sterol-4alpha-methyl oxidase/ C-4 methylsterol oxidase5871e-060

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
84  17%
 
203  13%
 
114  17%
 
62  9%
 
93  13%
 
73  13%
 
103  13%
 
211  4%

Unigene MembersMember information