Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10591

FASTA Sequence
Unigene ID: UN10591Length: 949  SNP
ACTTTGTGGAAACAAACTTTATTTTAAAATGCACTACTTAGGATCCAATACAAACCACCACACAAACACTGACGCTTGCCCTCACG
TATTATTAGGAAACACACAAAAACCAAAGCTAAAAGAGAACGAAAGCAGAGCACAGCATCATCAGAAACAAAAGACACAACACAAG
GTTTTATTCAGTATCAGAGATTATTCTTCCTAAACTCAGCGGCGTACGCAACAATTTTCTCTTGGTCAGGGAGAGACTTAGACACG
CTCTCTTTCTGCATACACCTCTTAGCCCAAGCAATCAGTTTTGGACTCTCTGCCTCGATGCTGAAGTTACCAAACTTCTCATATGC
TCCGAACCAACTGTAGAATGTAATCAGTGAAATGTCTACATAGCCAAAGGTATCTCCACCAAAGTAAGGTTTGTCTCCAAGCTCAG
CTTCAAGAATCTTCACTGCCTCAATAAACTCCTTCACCCCTGCTGCTTGTTCCTCACCTTTCTTTCCCCATATCTTGAATTGGGCA
TCACTAAACTTCTTGTCCACGAAATCAGCCCAAAACCTAGCCTGAGCTTTCCCGTATGGATCAGAAGGGAAGAATGGGTTCTTGTC
AGACCAAGCCTCGTCCACGTACTGGACAACATTGAGGGACTCGCATACCGGTTTACCGTTGTGGATCAGAACCGGGACCTTCTTAT
GAATCGGATTACTTTGGAGGAGCAAAGGGCTCTTGTTCGTGAGATCCTCTTCTCTGGCCTCGAACACAACACCTTTCTCCCTCAAC
GCGACTCTAGCCCTCATACAGAACATGCTTGGCCAGTAATCAAGAAGAATCGTCGAGTTCGCCATTGGTTTAGATCACTAAAGCTC
ACAAAGAAATGATATGTTCTTGATTTATGTTCAAAGTGAACAATAGAGGTAGTGTGTGGTTCAGAAAGGTGCGACTGGATAATGAT
TTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABD36807 glutathione S-transferase [Brassica napus]11401e-122
BAJ34081 unnamed protein product [Thellungiella halophila]10622e-113
NP_177958 glutathione S-transferase TAU 20 [Arabidopsis thaliana]10397e-111
AAM64587 2,4-D inducible glutathione S-transferase, putative [Arabidopsis thaliana]10343e-110
NP_565178 glutathione S-transferase TAU 19 [Arabidopsis thaliana]8524e-089

Swiss-Prot top hits (Blast detail)Scoree value
Q03666 Probable glutathione S-transferase7742e-081
P49332 Probable glutathione S-transferase parC7732e-081
P46417 Glutathione S-transferase 37132e-074
P25317 Probable glutathione S-transferase parA7114e-074
P50471 Probable glutathione S-transferase MSR-16513e-067

TrEMBL top hits (Blast detail)Scoree value
Q2EGT6 Glutathione S-transferase11401e-122
Q8L7C9 2,4-D-inducible glutathione S-transferase, putative10395e-111
Q8LBS3 2,4-D inducible glutathione S-transferase, putative10342e-110
Q8LBS1 Glutathione transferase, putative8522e-089
Q9ZRW8 At1g78380/F3F9_118522e-089

Arabidopsis top hits (Blast detail)Scoree value
AT1G78370.1 ATGSTU20 (GLUTATHIONE S-TRANSFERASE TAU 20); glutathione transferase10402e-113
AT1G78380.1 ATGSTU19 (GLUTATHIONE S-TRANSFERASE TAU 19); glutathione binding / glutathione transferase8521e-091
AT1G17180.1 ATGSTU25 (GLUTATHIONE S-TRANSFERASE TAU 25); glutathione transferase8037e-086
AT1G78340.1 ATGSTU22 (GLUTATHIONE S-TRANSFERASE TAU 22); glutathione transferase7973e-085
AT1G17170.1 ATGSTU24 (GLUTATHIONE S-TRANSFERASE TAU 24); glutathione binding / glutathione transferase7463e-079

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
94  12%
 
109  27%
 
64  12%
 
118  24%
 
124  12%
 
84  12%

Unigene MembersMember information