Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10607

FASTA Sequence
Unigene ID: UN10607Length: 1734  SNP
ATACATTCGGATAAAAAATCTACAAGCATTTTGACATACCAATCGCAAACCAGACAAACACACACTAATTTTAAAACTCGCTTGAT
ATTATTATTAAAAGCCAACAAAATACAACAATTTCAATAAGAGAAAATAAAAACATTCAAGAAAAAATTACTCAAGAAAACCCTTT
TTGTTTTTACTGTTTGTTTCTTTATCTCTTCGCCTTGTGAATTCCAATCAGGCGGCCCTACAAAAGCATATTATATAGAGAGATAA
CAGAAGATTACTCTTTGATAGAGAGAGGAAATCTCTAGTGCTGGTACTTCATCTCAGACATGAGAAATCCAGGCATCTCATAGGAG
GCAGCGAACTTCTCAACATCAGCCTTGAGCTCCTCGATCTCTTTGTTGTTCACCAAACCCTTGTTGAAGTCCTTCAACAGCTTACC
ATGCTCCTTCTGGATGTTCAATGTCAGCGTCACTGATCGGCTCAAGAACTCTCCTATCATCTCAAAGTCCTTCTCCACCAATCCCC
TTGATGTCATCGCAGGAGTACCGATTCTTACACCTCCAGGAGCAAGAGCACTGCTGTCTCCAAAGACAGCATTCTTGTTCAAAGTA
ATGTCGCATAGATCGCACAGCTTCTCAACCTTGTTACCGGTCAATCCAAGAGGGCGAAGATCCCAAAGAACAAGATGGTTCTCAGT
TCCACCGGTTACAATACTGTATCCCTTGCCCATCAGGTAGTTTGCAAGGGCAACAGCATTAGCTTTCACCTGTTTCGCATAGACCT
TGAAACCAGGAGTATTAGCCTGCTTCAACGCAACAGCTAGAGCACCAATCTGGTGGTTGTGAGGACCACCTTGAAGCGCAGGGAAC
ACAGCAAAGTTGATTTTGTCCTCAAAGTCATAGACTGCACCCTCGGCTTGCCCCTTCTTTGGTGGTTTCGGGCCCTTCCTGTAGAA
GATCATACCAGCCCTTGGACCCCTCAAACTCTTGTGAGTTGTTGTTGTCACAACGTCACAGTACTCAAAGGGGTTTGCAGCTTCCT
GAGCAGCAACGAGACCACTAATGTGAGCCATGTCACAGAGCAAGAGAGCTCCAACCTTATCGGCAACAGCTCTCAATCTAGCGTAA
TCCCAATCCCTAGGGTAGGCACTACCACCACAGATGAGGAGCTTAGGCCTGAAATCCATGGCCTTCTCCTCAAGCTTATCGTAATC
AATGTAACCAGTGGTGAAGTTCACCTTATACGGAAGGCTCTCAAAGTAGATCGAAGTAGCAGAGATCTTCTTCCCACCGGACGTAT
AGTACCCATGCGTGAGGTGACCGCCCGAGGGGAGATCAAGCCCCATGATACGATCGTGAGGCTGGAGCAAGGCGGTGTAGGCGGCG
AAATTGGCGGGAGATCCGGAGTAGGGCTGGACGTTGACGCCCCATGAGGCGGAGTCGAGGCGGAAGGCTTCGAGAGCGCGGGAACG
GCAGAGATTCTCGATCAGGTCGATGAACTCGTTGCCTCCGTAGTAACGGTTACCGGGCATGCCTTCGGAGTATTTGTTGGTGAGCG
CGCTTCCGAGAGCTTCGATGACGGCGAAGGAGGTGAAGTTCTCGGAGGCGATGAGCTCGATTCCGCGGCATTGGCGGCGTTTCTCC
TTCTCGATGAGGTCGTGGATCTCTGGATCGACGGTTACGAGAGGGGTGTTTCCCCAGGCTGAGACTGGATCCATCTCTGAGAGAGA
TCTGGAAATGAGGA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002868327 hypothetical protein ARALYDRAFT_915517 [Arabidopsis lyrata subsp. lyrata]23412e-261
NP_193129 serine hydroxymethyltransferase 4 [Arabidopsis thaliana]23295e-260
AAM64493 hydroxymethyltransferase [Arabidopsis thaliana]23286e-260
AAG40343 AT4g13930 [Arabidopsis thaliana]23197e-259
ACJ11726 serine hydroxymethyltransferase [Gossypium hirsutum]22605e-252

Swiss-Prot top hits (Blast detail)Scoree value
Q54Z26 Serine hydroxymethyltransferase 115111e-166
Q54EW1 Serine hydroxymethyltransferase 214842e-163
P34899 Serine hydroxymethyltransferase, mitochondrial14205e-156
Q9SZJ5 Serine hydroxymethyltransferase, mitochondrial14099e-155
P49357 Serine hydroxymethyltransferase 1, mitochondrial13954e-153

TrEMBL top hits (Blast detail)Scoree value
O23254 Serine hydroxymethyltransferase23293e-260
Q8LBY1 Serine hydroxymethyltransferase23284e-260
Q9FPJ3 Serine hydroxymethyltransferase23195e-259
D2D306 Serine hydroxymethyltransferase22603e-252
B9S9Y7 Serine hydroxymethyltransferase22513e-251

Arabidopsis top hits (Blast detail)Scoree value
AT4G13930.1 SHM4 (serine hydroxymethyltransferase 4); catalytic/ glycine hydroxymethyltransferase/ pyridoxal phosphate binding23292e-262
AT4G13890.1 EDA36 (EMBRYO SAC DEVELOPMENT ARREST 37); catalytic/ glycine hydroxymethyltransferase/ pyridoxal phosphate binding20334e-228
AT1G36370.1 SHM7 (serine hydroxymethyltransferase 7); catalytic/ glycine hydroxymethyltransferase/ pyridoxal phosphate binding16203e-180
AT1G22020.1 SHM6 (serine hydroxymethyltransferase 6); catalytic/ glycine hydroxymethyltransferase/ pyridoxal phosphate binding15495e-172
AT4G32520.1 SHM3 (SERINE HYDROXYMETHYLTRANSFERASE 3); catalytic/ glycine hydroxymethyltransferase/ pyridoxal phosphate binding14133e-156

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  14%
 
77  19%
 
99  24%
 
86  16%
 
123  8%
 
204  11%
 
61  3%
 
111  3%
 
181  3%

Unigene MembersMember information