Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10621

FASTA Sequence
Unigene ID: UN10621Length: 928  SNP
GGAAACCAGTTTTACCTTTCAGTATTTAAAAAAAAAAAAAATTTGCGCAAAAGTGATAACAACAAAAAAGAAGCTCCAATAAAAAC
AAAACCAAAATGTCTCATTCCAATCTTTACGTTTACAAGCTACCAAATGCAAAACCGAAATTTCAAAGAGTAGAATCGAGACGAGT
ACAAACGCAGCAAGTATTAAACCAAAAGACAGATGCGAATTCTCAGTACTTAATCGGTGCAAGAACATCGAGCTGGGCTCCAAGTT
TCTCCTCTGCAACCTTCTCGGCCTTTGTCCTGAGCTTGATGAGCTGTTTCTTACGCTCATACACAGCCTGTGACCTCTCCTTTCTC
TTGACCTCAAGCTCCTTGATGGTGTCGTAGTGGTTCCAGCCAACCTCAGAAGAAAGACGGCCCAACAAGCAGTACTTGTGACCAGC
CTGGAGCCTCAAAACCTTGAGAGCATCAGGAATGACCATTCTCTTGACTTTGTCGTAAGGAGGAGGGACTCCTTCAAAAACCTTCA
AACGGGCAAGAGCAGCAGCTCCACGCTTGGTCTTGTGTGGAATCATCCCACGAAGGGTACGCCAGAAGATCTTGGAGGGAGCCCTG
AAGTGAATGGGACCGTGAGAAGGCTTAGTGTTCATGCGCTTCCTGAGAAACCTCATGTACTTCATCTTCTGACGAACCAGTCCACC
TGACAGACAAATCTCTTCGCATCGGACGACGACAACTCTCTGTCCGTTGAGCAACTCCTTGGCGATGATGGAAGCAAGACGCCCCA
ACATGTGGTGCCTCGCATCGACCACCACGCGCTTCGCGCATATCCCTGAACCAGACACCATCTCCTCCCTACTCGATTGATTCTCT
CGGGCTGCTTCTTCTCCCTTTCCAGCCGGTTAAAGAGAAGACTCAGTGTCGGATTATATATGACGCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_189127 60S ribosomal protein L13a-2 [Arabidopsis thaliana]10173e-108
XP_002883564 60S ribosomal protein L13A [Arabidopsis lyrata subsp. lyrata]10173e-108
AAL87341 putative 60S ribosomal protein [Arabidopsis thaliana]10163e-108
XP_002865669 60S ribosomal protein L13A [Arabidopsis lyrata subsp. lyrata]10092e-107
XP_002863167 predicted protein [Arabidopsis lyrata subsp. lyrata]10065e-107

Swiss-Prot top hits (Blast detail)Scoree value
Q9LRX8 60S ribosomal protein L13a-210171e-109
Q9SVR0 60S ribosomal protein L13a-310044e-108
Q9SFU1 60S ribosomal protein L13a-110035e-108
Q9FKC0 60S ribosomal protein L13a-410018e-108
O49885 60S ribosomal protein L13a9183e-098

TrEMBL top hits (Blast detail)Scoree value
B9RWI8 60S ribosomal protein L13a, putative9948e-106
A9PB37 Putative uncharacterized protein9859e-105
B6VC51 60S ribosomal protein L13A9795e-104
A9PHS9 Predicted protein9761e-103
B9S526 60S ribosomal protein L13a, putative9761e-103

Arabidopsis top hits (Blast detail)Scoree value
AT3G24830.1 60S ribosomal protein L13A (RPL13aB)10188e-111
AT4G13170.1 60S ribosomal protein L13A (RPL13aC)10053e-109
AT3G07110.1 60S ribosomal protein L13A (RPL13aA)10043e-109
AT5G48760.1 60S ribosomal protein L13A (RPL13aD)10026e-109
AT5G48760.2 60S ribosomal protein L13A (RPL13aD)10026e-109

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
128  20%
 
86  15%
 
182  5%
 
718  45%
 
191  3%
 
64  10%
 
201  3%

Unigene MembersMember information