Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN10623

FASTA Sequence
Unigene ID: UN10623Length: 1100  SNP
GGATATAAGAAATCACCTTTCATTCAGTATGGATATCCCTCTCTTCTACACAAACATCACAGTCTTATAACGCTTATTTTACTGAG
AAACAAGCATTAAAGAAGAGCAAAAAAGTATCCACAACAATGTATATGTCACCGTCTGTATCAAAACGCCTCCTTTTGGTCCCTAT
CTTGGCTGTGGTGGCCATACAACTTCTATTTGTACGCGCTGCTTCGTCAGTGAACATGACAAATACGTATCTACACCACAAATGCT
TTGTCAGTCAAGGGAAATACAAACCGGGAAGTCAGTATGAGAAAAACCTAAAACGTATCAGGAATGAAATCTCTCCTGAAAGTTTT
AAAAGAGGTTACAACTCTACGCACCTTGGTGCAGGTCCCGATTTCATAATCATGTTCCTTCAATGCCGCGGAGACACCCACGGGCC
CAAATGCCGTTCTTGCTATGCTAACGCCCAACCCGAGTTTTTTAAGAGATGTCCAAGATATAAAGGTGGAATAATATGGTACGACC
AATGTTCTTTATATTTTTCTACGATCGATTCTATAGGGATGATCGATTACGACAACAATTTCTGTATGTCCAATAAAAAGAAAGTA
GACGACTATCTATATAACGATTTAAAACCGCGGTATTTCATCGACGATTTGATACAAAATACCACTCGTGAAGCTAACCCGAAAGC
GCCGTACTACACGGTGGAGGAGAAGAAGGTGGCGAATGTAACGATATATGGAATGGCTGAGTGCTCCTTCGACATGTCGCAAAGAA
ACTGTAGGAAGTGTTTAGAACGAAATAATTTCTATTTTAGAAGATGTTTTCATAATAAAATAGGAGCCAGAGTTTTGGGTAAAAGC
TGTAGTTTTAGGTATGAGCTTTATCCTTTCATTTCCCCTGAGGCCGGTCCTAAATATTTGAAGTCTTAAAAAGCAATTTATAGAAA
AAGTATGCGGATCTTTTCTTTTATGAAAGTTTTAAATTTTATTTTGTATTGATATCTTTGTATTTATTATTTTATTTAGACAAAAG
TGTATGATGTAGTTTAAATAAATCTATACTCCTCGTACAGATTATCTTGCAATTTTAAATTTTCTTGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
Q9LRL9 RecName: Full=Putative cysteine-rich repeat secretory protein 20; Flags: Precursor5802e-057
XP_002878210 hypothetical protein ARALYDRAFT_348900 [Arabidopsis lyrata subsp. lyrata]5334e-052
Q9LRK0 RecName: Full=Putative cysteine-rich repeat secretory protein 37; Flags: Precursor5245e-051
NP_188843 putative cysteine-rich repeat secretory protein 35 [Arabidopsis thaliana]5228e-051
Q9LRL8 RecName: Full=Putative cysteine-rich repeat secretory protein 21; Flags: Precursor5211e-050

Swiss-Prot top hits (Blast detail)Scoree value
Q9LRM1 Cysteine-rich repeat secretory protein 186318e-065
Q9LRM0 Putative cysteine-rich repeat secretory protein 196211e-063
Q9LRL9 Putative cysteine-rich repeat secretory protein 205807e-059
Q9LRK6 Putative cysteine-rich repeat secretory protein 315458e-055
Q9LRK0 Putative cysteine-rich repeat secretory protein 375242e-052

TrEMBL top hits (Blast detail)Scoree value
A5BKB5 Putative uncharacterized protein3254e-028
B9HE45 Predicted protein3148e-027
C6T3G7 Putative uncharacterized protein (Fragment)3148e-027
B9RPP7 DUF26 domain-containing protein 2, putative3112e-026
Q84JR6 Putative uncharacterized protein (Fragment)3093e-026

Arabidopsis top hits (Blast detail)Scoree value
AT3G21920.1 pollen coat receptor kinase, putative6317e-066
AT3G22010.1 receptor-like protein kinase-related5457e-056
AT3G22050.1 receptor-like protein kinase-related5223e-053
AT3G21910.1 receptor-like protein kinase-related5116e-052
AT3G58310.1 receptor-like protein kinase-related5091e-051

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
125  12%
 
94  9%
 
1011  26%
 
87  16%
 
116  14%
 
65  12%
 
75  12%

Unigene MembersMember information