Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN11008

FASTA Sequence
Unigene ID: UN11008Length: 1323 SSRSNP
GGACTCTCAGCCAGTGCTTGTGTTCACTGGTGATAAGGCGCTTCGTTGTTACCAACTACCCGATCTGATAAGCATTGTAGGCTTAC
GTCATCAATGGCTTCTTTCATGCTTAACGGTGCCATCACCTTCCCCAAGGGATTAGGTTTCACCGGTTCCAAACTCCAAGCGAGAT
CAATTCCTCCGCTGAGCTTGGTCCCAAACACAGCCGCCGCCACGACGCGGAGACCCTCAGTGGCAACCAGATGCAGCAGCAGCAGC
AGCAGCGTGTCGGCGCCAAGGCCATCTGCGCAGCCCAGGTTCATTCAGCACAAGAAGGAGGCCTACTGGTTCTACAGGTTCCTGTC
CATCGTGTACGACCACATCATCAATCCCGGCCACTGGACGGAGGATATGAGGGACGACGCTCTCGAGCCGGCGGATCTGAACAATC
CTAACCTGCGCGTAGTCGACGTCGGAGGCGGGACTGGTTTCACCACGCTGGGCATCGTCAAGACGGTGAAAGCTAAGAACGTGACG
ATTCTCGACCAGTCGCCACATCAGCTGGCCAAGGCGAAACAGAAGGAGCCGTTGAAGGAGTGCACGATCGTGGAAGGAGATGCAGA
GGATCTCCCTTTTCGTACTGATTATGCCGACAGATACGTCTCTGCTGGAAGCATTGAGTACTGGCCTGACCCGCAGAGGGGAATAA
GGGAAGCCTACAGAGTTCTCAAGATCGGTGGGAAAGCATGTCTAATTGGCCCTGTCCACCCAACCTTCTGGCTTTCTCGCTTCTTT
GCAGATGTCTGGATGCTTTTCCCCAAGGAGGAAGAGTACATTGAGTGGTTCACCAAAGCTGGTTTCAAGGACGTTCAGCTTAAGAG
GATTGGCCCCAAGTGGTACCGTGGTGTTCGCAGGCACGGTCTTATCATGGGATGCTCTGTCACCGGTGTCAAACCTACCTCTGGTG
ACTCTCCTCTCCAGCTTGGACCAAAGGAAGAGGACGTAGAGAAGCCTGTAAACAATCCTTTCTCCTTCTTGGGACGCTTCCTCTTG
GGTACCCTAGCGGCTGCCTGGTTTGTGTTAATCCCGATCTACATGTGGATCAAGGATCAGATCGTTCCCAAAGACCAACCCATCTG
ATCTGATAAAAGAACCTTATGTATGATTTGTAATACACTCCTCCTATCTTAGACACACTTTTTTTTGTTCTCAGTGACTAATGAAC
CCTTTTCAAAATATATCTATCAACTCTATTCCACCATGTTGATCTCAATTCTATGCTACTGTTCGATATTGTTGTTTCCGCAAACA
TGGGTTCCCAAACAATTATGAGTATATGAGCTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ACD03289 MPBQ methyltransferase [Brassica napus]16492e-181
NP_191900 MPBQ/MSBQ methyltransferase [Arabidopsis thaliana]16081e-176
BAB62076 APG1 [Arabidopsis thaliana]16026e-176
XP_002878516 hypothetical protein ARALYDRAFT_907927 [Arabidopsis lyrata subsp. lyrata]16026e-176
ABF85788 At3g63410 [Arabidopsis thaliana]15991e-175

Swiss-Prot top hits (Blast detail)Scoree value
P23525 37 kDa inner envelope membrane protein, chloroplastic13488e-148
C3MCY6 Ubiquinone/menaquinone biosynthesis methyltransferase ubiE1571e-009
Q8UIH5 Ubiquinone/menaquinone biosynthesis methyltransferase ubiE1506e-009
B9J7S8 Ubiquinone/menaquinone biosynthesis methyltransferase ubiE1471e-008
B5ZYK8 Ubiquinone/menaquinone biosynthesis methyltransferase ubiE1443e-008

TrEMBL top hits (Blast detail)Scoree value
B2ZC81 MPBQ methyltransferase16492e-181
Q9LY74 AT3G63410 protein16089e-177
Q94IE2 APG116024e-176
Q1EC48 At3g6341015991e-175
Q8LDQ3 Putative chloroplast inner envelope protein15972e-175

Arabidopsis top hits (Blast detail)Scoree value
AT3G63410.1 APG1 (ALBINO OR PALE GREEN MUTANT 1); 2-methyl-6-phytyl-1,4-benzoquinone methyltransferase/ S-adenosylmethionine-dependent methyltransferase/ methyltransferase16221e-180

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  6%
 
112  12%
 
191  6%
 
216  35%
 
181  6%
 
201  6%
 
94  24%
 
61  6%

Unigene MembersMember information