Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN11098

FASTA Sequence
Unigene ID: UN11098Length: 946  SNP
TAGGTTGTTCTTTTAGATCTTCGCTTCGCCGTCGCTTCTCACCGGCCCTTCTCTATATCTTTAGCTTTAACAACCCAATGGCCACT
CAAGCTGCAGCTGCTGCCTCTTTCAATGGCAACCTTAAGAAAGCTGTGGCAGGTATAAAGCGTATCAATCTCGACGGTCTTCGTTG
GCGTGTTTTTGATGCCAAAGGCCAGGTTCTCGGTAGACTTGCCTCTCAGATCTCTACTGTCCTTCAAGCCAAAGATAAGCCTACTT
ATTGTCCTAACCGCGATGATGGCGATATTTGTATCGTTCTCAATGCTAAGGATATCGGCATCACCGGTAGAAAGCTCACCGACAAG
TTCTACCGCTGGCATACTGGGTACGTTGGACACCTGAAAGAACGAAGTCTGAAAGATCAGATGGCCAAAGACCCCACCGAGGTCAT
CCGTAAGGCTGTCTGGCGCATGCTTCCTACTAACAACTTGCGTGATGACAGAGATCGGAAGCTGAGGATCTTTGAAGGCAATGAGC
ATCCTTTTGGGGACAAGCCACTCGAGCCTTTCGTCATGCCTCCTCGTACCGTGAGAGAGATGCGACCCCGCGCTAGACGTGCTATG
ATCCGTGCCCAGAAGAAGGCAGAGCTGGCAGAAAATGGTGGAACTGAGGTTAAGAAAGGCAAGAAGAGGACTCCCTCTCAAGTAAC
TACTGCCTAGAAGAAAAGCTTCAGACAGCAACTTAGTAGTGTGATTCGTATCTTTATATAATAGGCGGCAGGCGTGGATAAGCTTG
TAAGGTTTTCTTGTTTCTGGATGCCAGACAATAATATACTCTCGTTTCTGTCCCTTTTCTTCCATTTCACACCTGCTCGATTACAC
AAGTGTCGCTAGCAGGCTTTTGTTCTCTCGGTCGTTTGTTTGTTATCATCCAAATTTTTATTTTTATATGATTCCAATGTTTGCTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002882166 ribosomal protein L13 family protein [Arabidopsis lyrata subsp. lyrata]10138e-108
NP_186828 large subunit ribosomal protein L13 [Arabidopsis thaliana]10002e-106
XP_002323992 predicted protein [Populus trichocarpa]8703e-091
XP_002509553 50S ribosomal protein L13, putative [Ricinus communis]8391e-087
XP_002270526 PREDICTED: hypothetical protein [Vitis vinifera]8372e-087

Swiss-Prot top hits (Blast detail)Scoree value
Q1AU63 50S ribosomal protein L133233e-029
Q18CJ1 50S ribosomal protein L133208e-029
B3EMI6 50S ribosomal protein L133082e-027
O67722 50S ribosomal protein L133037e-027
A1AXJ2 50S ribosomal protein L133011e-026

TrEMBL top hits (Blast detail)Scoree value
Q7XA68 At1g0164010002e-106
B9IJJ7 Predicted protein8702e-091
B9RBL9 50S ribosomal protein L13, putative8398e-088
B9GJD1 Predicted protein8362e-087
A9PG49 Putative uncharacterized protein8309e-087

Arabidopsis top hits (Blast detail)Scoree value
AT3G01790.1 ribosomal protein L13 family protein10001e-108
AT3G01790.2 ribosomal protein L13 family protein10001e-108
AT1G78630.1 emb1473 (embryo defective 1473); structural constituent of ribosome1962e-015

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
182  15%
 
61  8%
 
103  23%
 
113  23%
 
201  8%
 
211  8%
 
71  8%
 
81  8%

Unigene MembersMember information