Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN12040

FASTA Sequence
Unigene ID: UN12040Length: 1185  SNP
GTTCCAATTGTTTCTATACTTCCTTGAATCATACATTTAGCACTCCAAAAGACACACATGGGTTTATTAAAATAACAATAGAAGAA
CCCTCCTTTATTTAGATAGCCAATAGACAAGACAAACGTACATTAAGATATAAGACAAACCAAAAACAACAACAATAGACCATGCA
ACTCCATAAGTTCACATGATAATCTTATTCATACACAATATAAGATTGGTTCTGCATCAGTTGGCTATGGGCGCCACTCTAACTCC
GATCTTGTAAAGAAACTCACCAGCTTGTCCATAGAACCCAACGACCTTGTGGTCTTTCTTCTCCAGCACGAATTCAGTTCCTGAGT
CCATTCCATACGGGTCAGAAATTCTCTTGTTTGTCTTGAATTTAAGACAGATGATCGCCGGTGCATCGACACCATAAATCTTGTCA
TAGTAGCCTATCACACCTGTGAGATATTCACCATCTTCAAGCACAAACTCTTCAGCATCAAGCAATGACTTCTTCCCATGAACACT
TCCAAGGACAGGCTTTGAAGCATTTACATACTCAGCCTCGAAATAAGTCACACAAGAGTCACCTTGTCCTACATATATCTTCTTCA
CACCGTCGTGAACACCATCGTCCCACTTAACTCCAGCGTCTCCACCTTGTGCTGGAATAGTATCGACGGGAGTCACTGGTGTTGAC
GTAGGAGCAATATAAACTCCAAGAGAGTGGATCACGTCGCTTGCACTTCCATGGAATCCAACGATTTTGCCACCTCCTAGCTCTGC
TTCTTGTCCAGAGGCCATTCCAAACGGCTGAGAAACTTTTCCCTTGAATGTCTTGAAGATAAGAGCGGTGATGATCTCTGTTGGTG
TTCCAAAGAGTTTCTCGTAGTAAACTTTTACAGATGTTATGTAATCATCTGAATCAAGCTCAAACTCCTCTGGGTCAAGTAACGTC
TTTTTACCATGTTCGAGTGGTACAATCTTCCCATCTTTCTCATAATCAAACTTGACATAAACCACACCAGAGTCACCTTGTCCAAC
ATACACTTTCTTGACATTCTCATAAGCACCACCATCGTCCCATAACTCTCCTCCGCGGCCACCTTGAGCATCCAACTTTTTCGCCA
TTGTTCTTTCTTAAGCCTAAATTTAATTAAAAACGCATATGAAAATTATAGAAGATTCACGAACATA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_001189913 myrosinase-binding-like protein [Arabidopsis thaliana]12746e-138
AAM64528 putative lectin [Arabidopsis thaliana]12721e-137
NP_566547 myrosinase-binding-like protein [Arabidopsis thaliana]12657e-137
XP_002885141 hypothetical protein ARALYDRAFT_479107 [Arabidopsis lyrata subsp. lyrata]12602e-136
BAA84545 myrosinase binding protein [Arabidopsis thaliana]8113e-084

Swiss-Prot top hits (Blast detail)Scoree value
O04309 Myrosinase-binding protein-like At3g1647012653e-138
Q9SAV0 Myrosinase-binding protein-like At1g520408504e-090
Q9SAV1 Myrosinase-binding protein-like At1g520308253e-087
O80948 Myrosinase-binding protein-like At2g393307375e-077
O04312 Myrosinase-binding protein-like At3g164407375e-077

TrEMBL top hits (Blast detail)Scoree value
Q8LBW1 Putative lectin12727e-138
Q94AD4 At1g52040/F5F19_108523e-089
O65187 Myrosinase-binding protein homolog8506e-089
Q8LAM1 Putative lectin7637e-079
O04311 AT3G16450 protein7592e-078

Arabidopsis top hits (Blast detail)Scoree value
AT3G16470.1 JR112662e-139
AT3G16470.2 JR112662e-139
AT1G52040.1 MBP1 (MYROSINASE-BINDING PROTEIN 1); protein binding8503e-091
AT3G16450.1 jacalin lectin family protein7609e-081
AT3G16450.2 jacalin lectin family protein7609e-081

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
102  11%
 
86  32%
 
95  26%
 
73  16%
 
62  11%
 
201  5%

Unigene MembersMember information