Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13046

FASTA Sequence
Unigene ID: UN13046Length: 949  SNP
ATTACGAAGAAAAAGCAGTTTGTATCAGTTTCAAATTACACAAATCAACAAAATTTCAACATCACAAGAAAAAGAAACGAAATAAA
AATTTAACAACACAAAACTTGAAAATTTGAACATATATATGTAACTATGAATATTCAAAATAAAGTCGGAAAAATGAATATTCAAA
ATAATAAATTCCGTAAAATATTTTATTGCAGGGGGATACTGGAAGCGTAAACTTCTTTCCGTATATGTGAAGATAACGTGTTGTTG
TTGGTTCATCTCCTCAAGGTATGGAGAATATACTCAGCGTACAGATCCATGGAGTACTGGATTGCTTCATGTGCCTTCTCCGATGG
CAAGAAATCGTTTACAGCCACCTCCTTGTGCTCGTTCTTCTTGTAGTCTTCGAAGAAACGGCGGATTTCTGAGAGGCGGTGAGGAG
CGAGTTGTTTGATGTCGGTGAAATGTTTGTACTCTGGATCGTCTGCACATACGGCTATGATCTTGTCGTCCATCTCTCCCTGATCA
ATCATGGGCATTAATCCAATGGCTCTAGCACGAAGAAAACATCCTGGAAGCACTGGTTCCTGCATGAGGACAAGAACATCAAGAGG
ATCGTTGTCTTCACACAATGTCCTTGGGATGAATCCGTAGTTGTGAGGATAAACAACCGATGAGTACAAGATTCGATCAACCTTGA
TAAGACCAGTCTTTTTGTCAAGTTCATATTTCACTTTGCTCCCCTTTGTGATCTCAACCACCACGTTGAAGACTAATGGAGCTTCA
GGACCGATCTCAAGGTCGTGCCACGGATGCGCAGCTACAGATCTCCTGGATAGAGTTGAGAGGATCCTCTCGTTCAGCTTTGGAGC
AGGACGAGGAGATTGACTTGTTTCCATCGTTTCTTCATATGTTTCTTCACTCATCTTTGGATCCTTGTTTCGTTTAAAAGGGACAA
AAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880270 hypothetical protein ARALYDRAFT_483853 [Arabidopsis lyrata subsp. lyrata]11015e-118
NP_182209 pyrophosphorylase 3 [Arabidopsis thaliana]10882e-116
BAC42722 putative inorganic pyrophosphatase [Arabidopsis thaliana]10836e-116
XP_002320239 predicted protein [Populus trichocarpa]9976e-106
NP_171613 inorganic pyrophosphatase [Arabidopsis thaliana]9959e-106

Swiss-Prot top hits (Blast detail)Scoree value
Q43187 Soluble inorganic pyrophosphatase9391e-100
O48556 Soluble inorganic pyrophosphatase9301e-099
A2X8Q3 Soluble inorganic pyrophosphatase8611e-091
Q0DYB1 Soluble inorganic pyrophosphatase8611e-091
O23979 Soluble inorganic pyrophosphatase8432e-089

TrEMBL top hits (Blast detail)Scoree value
O82793 At2g4686010881e-116
Q8GXR0 Putative inorganic pyrophosphatase10834e-116
A9PDZ2 Predicted protein9974e-106
Q93V56 At1g01050/T25K16_59957e-106
D1MVT0 Inorganic pyrophosphatase9884e-105

Arabidopsis top hits (Blast detail)Scoree value
AT2G46860.1 AtPPa3 (Arabidopsis thaliana pyrophosphorylase 3); inorganic diphosphatase/ pyrophosphatase10895e-119
AT1G01050.1 AtPPa1 (Arabidopsis thaliana pyrophosphorylase 1); inorganic diphosphatase9963e-108
AT4G01480.1 AtPPa5 (Arabidopsis thaliana pyrophosphorylase 5); inorganic diphosphatase/ pyrophosphatase9391e-101
AT3G53620.1 AtPPa4 (Arabidopsis thaliana pyrophosphorylase 4); inorganic diphosphatase8923e-096
AT2G18230.1 AtPPa2 (Arabidopsis thaliana pyrophosphorylase 2); inorganic diphosphatase/ pyrophosphatase7983e-085

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
66  20%
 
115  17%
 
181  3%
 
84  13%
 
96  20%
 
122  7%
 
75  17%
 
101  3%

Unigene MembersMember information