Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13047

FASTA Sequence
Unigene ID: UN13047Length: 1042  SNP
GGACCCATCTCTTGGCTCACAAACAACAACAAATAAACGTTTTATTCTTTCTGCTCAGCACTCAACCGCAATGGCCGCCTCAACAA
TGGCTCTCTCCTCCCCTGCCTTCGCCGGAAAGGCCGTTAAGCTTTCCCCAGCAGCATCAGAAGTCCTTGGAAGCGGCCGTGTGACA
ATGAGGAAGACCGTAGCCAAACCAAAGGGCCCATCAGGCAGCCCATGGTACGGATCCGAGAGAGTCAAGTACTTGGGTCCATTCTC
CGGCGAGCCACCGAGCTATCTTACCGGAGAGTTTCCCGGAGACTACGGATGGGACACCGCCGGTCTCTCAGCCGATCCCGAGACGT
TCGCAAGGAACCGTGAGCTAGAAGTTATCCACTGCAGATGGGCCATGCTCGGAGCCCTAGGCTGCGTCTTCCCGGAGCTGTTGGCC
AGGAACGGTGTCAAGTTCGGAGAGGCGGTTTGGTTCAAGGCCGGTTCGCAGATCTTCAGCGAAGGAGGGCTTGATTACTTGGGAAA
CCCTAGCTTGGTTCACGCTCAGAGCATCTTGGCTATTTGGGCTACTCAAGTGATCTTGATGGGAGCCGTTGAAGGTTACAGAGTCG
CAGGTGATGGGCCGTTGGGAGAGGCCGAGGACTTGCTTTACCCAGGTGGTAGCTTTGACCCGTTGGGTTTGGCTACTGACCCAGAG
GCCTTTGCGGAGTTGAAGGTGAAGGAGATCAAGAACGGAAGATTGGCTATGTTCTCTATGTTTGGATTCTTTGTTCAAGCTATTGT
CACTGGTAAGGGACCTTTGGAGAATCTTGCTGACCATTTGGCTGATCCAGTCAACAACAATGCATGGGCTTTTGCTACCAACTTTG
TTCCCGGAAAGTGAGCAAAGTTTTTATCTGTAATTTGCTTCAGTATTTGCTTTGTGTTAAGGGGAGAAAGAGATGTTGTTTAGATG
TAAAATTTGCAAGTATTTGTATGATTTACCATTTAATCAAATAACTCTTTGTCTTATCAACTGTGTCGTAGAACTAAATGGAAATG
GATTTTATGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABG29728 chloroplast chlorophyll a/b binding protein [Brassica napus]13992e-152
AAP44089 chlorophyll a/b binding protein [Brassica oleracea]13793e-150
NP_174286 chlorophyll a-b binding protein 1 [Arabidopsis thaliana]13732e-149
NP_564339 chlorophyll a-b binding protein 2/3 [Arabidopsis thaliana]13686e-149
P13851 RecName: Full=Chlorophyll a-b binding protein 1, chloroplastic; AltName: Full=LHCII type I CAB-1; Short=LHCP; Flags: Precursor13614e-148

Swiss-Prot top hits (Blast detail)Scoree value
P04778 Chlorophyll a-b binding protein 1, chloroplastic13737e-151
P04777 Chlorophyll a-b binding protein 2/3, chloroplastic13683e-150
P13851 Chlorophyll a-b binding protein 1, chloroplastic13612e-149
P27495 Chlorophyll a-b binding protein 40, chloroplastic12662e-138
P07370 Chlorophyll a-b binding protein 1B, chloroplastic12625e-138

TrEMBL top hits (Blast detail)Scoree value
Q153I7 Chloroplast chlorophyll a/b binding protein13991e-152
Q7Y1A1 Chlorophyll a/b binding protein13792e-150
Q8VZ87 Chlorophyll a/b-binding protein13604e-148
Q8W159 Chlorophyll a/b binding protein13561e-147
Q39141 At2g34420/T31E10.2413523e-147

Arabidopsis top hits (Blast detail)Scoree value
AT1G29930.1 CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding13745e-152
AT1G29910.1 CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding13692e-151
AT1G29920.1 CAB2 (CHLOROPHYLL A/B-BINDING PROTEIN 2); chlorophyll binding13692e-151
AT2G34420.1 LHB1B2; chlorophyll binding13531e-149
AT2G34430.1 LHB1B1; chlorophyll binding13361e-147

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
84  7%
 
127  12%
 
104  7%
 
68  13%
 
115  8%
 
1929  48%
 
182  3%
 
201  2%

Unigene MembersMember information