Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13077

FASTA Sequence
Unigene ID: UN13077Length: 1352  SNP
GCGATAAATATTTAACTCTTTAATGATCAAGTCTAAGTGTAAACAAAGTTGAGAAAGAAGCAAATTAACCATATTATAATTCTTCA
TGGGTTGAATTATTTAATGTCTATAACATTTTCACGGCGAACAAGTTCCGGTCACCGGAAACAACAACAACAAACCACAACACAGT
AACACAGAATATCTTACAGACACAAACTTCTCCATCTCTTATCTTAAACCGATGCAACAGAAATCTCATCTGAACCGGTTGTAACC
TTGAACACATTCTTGGTTGAAGGCAAACCACCCACTGGTTCATCTTCAATTCCACATTCATTTGTTCCTCTCCTAATCATGAAATA
ACCATCATCACCCCAGCTTCTGTTCCATTGATTTGCCAACAACCAATAATCTTCTCCATCATCAGTAGTTCCCCAACCAATAAGTT
TCACAGCATGACCTCCAATGTTAGAGCCTGTTATGTGCTTGTACACTCCAGATTTGTAATGAGCAAAGTCCTCATAAACTGTGAAA
GAGACTTCGACAGGTCCATTCTTGTAAATCTCAGCCATGATATCTTGAGGATTAGACTCGACAACGTATGTATTAATACTGTAATG
TTTTGACTCGCTCCATAATTGGTTTCTGCCAACGCATTTCCTCAGGCATTGCGGTGTATTGTATGCAGGTTCACAGCCAGGGTGTG
AGCATCCGGTTTGATCAAAGTATGGATCACACTCTTCAGTGACAACACCACTGTAGGAAAAGTATTGCCAAGCAGAAATTGGGTAG
CCACCGTCACAACCGTCACCACAACGGAATCCACAGCATGCTAAGAGATCATTTACTGATAAAGTAATGTTCATTCCAAATTGGAT
ACAGAATCTATCAGATAGTGATTCAACAGCACCAAATGCCCAGCAAGAACCACAATGTCCCTGATCTAAGATTTTTCCAATACTGG
TGCATTGAGGCCAATGTGTTCTAGCATCGAATGATTTAGGTAACTTCAGAGATTGATCATGGCTTACAACAGGAACACCTAAGAGT
AACTTCTTAGGTGTTGGTTTAACACCAAGGAGACGCTTAAACTCTGCTACAGTTGCGTTAGAGAAACGATCATTAATAGCAGCTTT
CCATCCAGCGTTCGGATGTTCGTTGACCTTCTTCACTATCTCTTCCTGAAGTATCTTCGAGCTCAGTTTCTGTTTGGTAAGATTCT
CTGCTGCAACTCCCTGCAAGTCGAGAGACGAGGAGACAAGGCCTAAGAGCAAGACAACAGAGACCAAACAGAGTTTGGTTGTAGAA
TCAGCAGCCATGGTTTTGGAATCCCAGAAGATTAAAAGATCTCGTTGTAGAAGCAACCCTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAG69285 cathepsin B-like cysteine protease [Raphanus sativus]18348e-203
BAJ34434 unnamed protein product [Thellungiella halophila]17792e-196
XP_002874969 hypothetical protein ARALYDRAFT_490415 [Arabidopsis lyrata subsp. lyrata]17228e-190
NP_567215 cathepsin B [Arabidopsis thaliana]17102e-188
NP_849281 cathepsin B [Arabidopsis thaliana]16968e-187

Swiss-Prot top hits (Blast detail)Scoree value
Q5R6D1 Cathepsin B7483e-078
P07858 Cathepsin B7465e-078
P10605 Cathepsin B7189e-075
P25792 Cathepsin B-like cysteine proteinase6902e-071
P43157 Cathepsin B-like cysteine proteinase6892e-071

TrEMBL top hits (Blast detail)Scoree value
B5BQV5 Cathepsin B-like cysteine protease (Fragment)18346e-203
Q94K85 Cathepsin B-like cysteine protease17101e-188
Q9ZSI0 Cathepsin B-like cysteine protease16966e-187
Q93VC9 At1g02300/T6A9_1015326e-168
B9GRU7 Predicted protein14019e-153

Arabidopsis top hits (Blast detail)Scoree value
AT4G01610.1 cathepsin B-like cysteine protease, putative17116e-191
AT4G01610.2 cathepsin B-like cysteine protease, putative16972e-189
AT1G02305.1 cathepsin B-like cysteine protease, putative15323e-170
AT1G02300.1 cathepsin B-like cysteine protease, putative10638e-116
AT3G45310.1 cysteine proteinase, putative1864e-014

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
912  44%
 
182  7%
 
122  7%
 
78  30%
 
201  4%
 
211  4%
 
81  4%

Unigene MembersMember information