Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13086

FASTA Sequence
Unigene ID: UN13086Length: 769  SNP
CAAAAGTAAAAAACTATGGTAATGGTTGATATTAATTATTTATAAAAAGACATGTCTAATAATAAATAGATTAATATAACATTAAT
TACATAAGGTCCAACTTTAAAATTCACCTAGAAGAAGTTGTAATGTTTCTGTTTTAATAAGATAGATTGATCCTTTGGAGTGTTTT
GGCATTAGACGTTTACCCCAGAAAGCCACAAATAATATGAGAAAGTAAACTTTATTTAACCATATAAACCATTACATACTAACGGT
TATTTTATTTCATAAAACAGCTTGATATAATGTTATTCATCTTCCTTACTCGTAATTTATTTATTTGTAAAAACTCTTAAGAGTTT
TAACAACTTGGGTAAGGAATGCCACAGGCGGTTAGGACTTTGCGAGAGTTGGGAGAGCTAATGTACTGAGCAAAAGCAGGGTTCTT
AGCAAACCCGCACAAGCATGATTGTTGCTCCTTCAGCTTTGCACAACAGTCACCCGAGGGTTGTCCTCCTCCAGTAATCGCGGGCA
GGCAAGGCTGTAGCTGCTTTGGATCACATGCTGCTCCCAAATTTGTGTCTGCCGCTTTGTTTGGAGCGGGAAACGATGTCAGAAGT
ATGACGAAAACCATGAGTGTCAAGACCATGATCTTCATGTCTACTAAATTATTTGTATATGTTAAGCTGTTTTAGTTTTACAGTGT
TTAATATATTTGCTCAGGAACATTTGAATCTCGTTTTTGTTATTTATTGGGTATGGGTTCATATTGCTTTGCATAATGCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAA25680 Lipid transfer protein [Brassica rapa]4356e-041
NP_176857 bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin-like protein [Arabidopsis thaliana]3962e-036
XP_002887080 hypothetical protein ARALYDRAFT_475781 [Arabidopsis lyrata subsp. lyrata]3863e-035
ACJ68112 hypothetical protein [Brassica napus]2932e-024
XP_002870864 protease inhibitor/seed storage/lipid transfer protein family protein [Arabidopsis lyrata subsp. lyrata]2733e-022

Swiss-Prot top hits (Blast detail)Scoree value
Q43681 Probable non-specific lipid-transfer protein AKCS92444e-020
P20145 Probable non-specific lipid-transfer protein2426e-020
P82353 Non-specific lipid-transfer protein 22131e-016
P83506 Probable non-specific lipid-transfer protein 21871e-013

TrEMBL top hits (Blast detail)Scoree value
O64431 Lipid transfer protein (Fragment)4354e-041
Q9C9N7 At1g668503961e-036
D2CVS0 Putative uncharacterized protein2931e-024
B9H330 Predicted protein2633e-021
Q6PZE3 Lipid transfer-like protein2572e-020

Arabidopsis top hits (Blast detail)Scoree value
AT1G66850.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein3976e-039
AT5G38195.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein2571e-022
AT2G14846.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein2417e-021
AT5G38160.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein2328e-020
AT1G48750.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein2255e-019

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
911  16%
 
109  13%
 
621  31%
 
118  12%
 
123  4%
 
710  15%
 
86  9%

Unigene MembersMember information