Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13303

FASTA Sequence
Unigene ID: UN13303Length: 493  SNP
GGATCAATCTCTCCCTTGTTGTGAATTTCGGAGCGAAGAAAAAAAAAGAGAAAAGAAGATCGGAGATGGCATCGACGGCGGCGGTT
CCGTTCTGGAGAGCGGCGGGGATGACTTACATTACCTACTCAAACATTTGTGCGAATCTCGTGAGGAACTGTCTCAAGGAGCCTTT
CAAAGCTGAAGCCCTTAATCGCGAGAAGGTTCATTTCTCGCTCTCCAAATGGGCTGGCGGAAAGCCTGAGAAACCAATTCTGCGTT
CTGACACACCTGGAGTTTGAGATTTTTTTAGCGTTTCGATATCAAGTTTGAGGTTAATAATGGTGAGGAATGCAAGATATTATGTA
CTCTGCAACATTTTCCTTCTTTTGACTTTAAGATTGTTAACAATGGAGTTCGAGTGAGAGAGAGTGACCTCATTCCTATCTTGAAA
CTTTTTTTTTTTGAAAATGGCTTTCAAATTAAAGAGCAAAAATAAAAAAAGTTTACTATCTTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_175576 ATP synthase subunit epsilon [Arabidopsis thaliana]3302e-029
XP_002891649 ATP synthase epsilon chain, mitochondrial [Arabidopsis lyrata subsp. lyrata]3292e-029
ACS83605 ATP synthase epsilon subunit 1 [Gossypium hirsutum]3184e-028
ACU13312 unknown [Glycine max]3184e-028
XP_002517228 ATP synthase epsilon chain, mitochondrial, putative [Ricinus communis]3175e-028

Swiss-Prot top hits (Blast detail)Scoree value
Q96253 ATP synthase subunit epsilon, mitochondrial3302e-030
Q06450 ATP synthase subunit epsilon, mitochondrial3112e-028
Q41898 ATP synthase subunit epsilon, mitochondrial2801e-024
Q75JK6 ATP synthase subunit epsilon, mitochondrial1501e-009

TrEMBL top hits (Blast detail)Scoree value
C6GFP6 ATP synthase epsilon subunit 13183e-028
C6SVN9 Putative uncharacterized protein3183e-028
B9RU09 ATP synthase epsilon chain, mitochondrial, putative3174e-028
C6SXM9 Putative uncharacterized protein3084e-027
C6T434 Putative uncharacterized protein3022e-026

Arabidopsis top hits (Blast detail)Scoree value
AT1G51650.1 ATP synthase epsilon chain, mitochondrial3311e-031

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
63  38%
 
92  25%
 
201  13%
 
82  25%

Software error:

can't close file: No space left on device at /var/www/cgi-bin/radish/EST/search.cgi line 576.

For help, please send mail to the webmaster (feibioinfolab@gmail.com), giving this error message and the time and date of the error.