Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13338

FASTA Sequence
Unigene ID: UN13338Length: 1389  SNP
GACTTGAGAGCCATTCACTCGAGAGAGGAAGAGAGACATGAAGACTGCCTTTCTCACCAAGCACTACTCTCTTCAACTCTAAATCA
GAGTATATTGTCTGGTGGCAAAACAAAACCAATGGCTATGGTGGTGTCTGGTGGCACGATGCCACTTCACGCCAATCCTCTTCCTC
TAAGTATCATCGACACCAAAACAAGAGTCCGGCCTGCATCATCCTCGTTTCCGCTATCCTCACCCGCTCCTCACACCCCTTCCACC
TCCCTCTCCATCCGCTTCAAGCCCTTTCATCATGTTTCCCGGTCTCTCTCTGTGGTATCTTCTCTTCTGTCAGAGGACAGAGCTAC
TGGAGTTAGTGGCTCCGGGACAGATGCACTCAAGCTGACATACTTTGAGGGAAATAGCTGGCTATGGGAAACAGGTGGATTGAAAA
TCTTGGTTGATCCCATTCTCGTTGGTAATTTGGATTTTGGAATCCCATGGCTCTATGATGCTGCCAAGAGATTTTTGAAACGCTTC
AAGCTTGATGATCTCCCTGAAGTTGATTGCTTGCTCATCACTCAAAGCCTTGATGACCATTGCCATCTAAATACCCTTAGGCCACT
TTCCGAGAAATCTCCAGACGTAAAGGTTATAGCAACTCCAAATGCAAAGCCTTTGCTTGATCCTCTTTTCAGAAATGTAACTTATC
TGGAACCTGGAGAGACCTACGAGCTAAATGCAAGAAACGGTTCTAAGGTTCGAGTTAAAGCCACAGCAGGACCTGTCCTCGGTCCA
CCATGGCAACGCCCTGAGAACGGGTATCTTCTTGTATCACCTGAAGATCAGATATCTCTCTACTACGAACCGCACTGTGTATGCAA
CATGGAACTTTTGAAAAGTGAAAGAGCCGACATTGTAATCACACCGGTCATCAAACAACTTCTCCCACAGTTTACTCTGGTTTCTG
GCCAAGAAGACGCTGTCCAGCTAGCCAAAATCTTAAAAGCCAAGTTTGTTGTGCCGATGCAAAATGGCGATCTTGATGCAAAGGGG
ATTTTAGCAAGTATTATAAAGAAAGAAGGAACGATAGAATCATTTAAGGAATTGTTATCAAGAGAGCTTCCAAAAGCTCAAGTGTT
GGAGCCCATAGCAGGTGTGCCGCTAGAGATCTTGCCTCCAACGTCAGACGTTTAGAATGTAACGGGTATATGAACATGACTCATGA
GGATACACACACATGTAAATATACTAGGCATTTTGTTGTTTTATTTTTCTGTAATGAACGATGATTATTGTTAGTACTGTGTTGAT
TATCTATGATCTTCGTGTTGTGTGTGACAATAGATATAAAACTCTCTCTATCTATCGTAGTCAAACAAGTTGATGTTTAATAAAAT
TAAGTTGTGTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002893575 hypothetical protein ARALYDRAFT_473173 [Arabidopsis lyrata subsp. lyrata]15418e-169
NP_564334 metallo-beta-lactamase domain-containing protein [Arabidopsis thaliana]15264e-167
XP_002529154 conserved hypothetical protein [Ricinus communis]11286e-121
XP_002281785 PREDICTED: hypothetical protein [Vitis vinifera]11189e-120
XP_002312382 predicted protein [Populus trichocarpa]11044e-118

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9C535 Putative uncharacterized protein At1g29700; T3M22.515263e-167
B9ST35 Putative uncharacterized protein11284e-121
B9HIZ8 Predicted protein11043e-118
A2ZN76 Putative uncharacterized protein8094e-084
Q2QLI3 Expressed protein8094e-084

Arabidopsis top hits (Blast detail)Scoree value
AT1G29700.1 unknown protein15323e-170

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
123  23%
 
115  38%
 
211  8%
 
82  15%
 
101  8%
 
61  8%

Unigene MembersMember information