Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13378

FASTA Sequence
Unigene ID: UN13378Length: 1768  SNP
GAGACGAGCTTAACTGTCTCTACATCAAAAGTTAATAATGGCTACTAGGGAAGAGAGAGATAAGTATAGATCTGTCCTTAACGATG
TAGGAGATGTCCAATGGAGGTATGGTCACCCTCCAGCTTTTGACCTTGTGAACCAGCTCTTTGAAGAAGGCCAGACCAAGGTATGG
CCAGAAGGATCCTTGGAAGAGACGGTTCAAAACGCAATCAAGTCATGGGAGATGGAGCTCTCACACAAGATCCGTTTACAAGACTT
CAAGACTATAAACCCTGATAAGTTTAAGCTCTTTGTCAATGGGAGAGAAGGATTATCAGCTGAAGAAACGCTTAGGCTTGGGAGCT
ACAATGCTTTGCTCAAGACCTCTTTACCTGGAGAGTTTCAGTACTATAAACCAGAAGAAGAGAGCTTCGAGTCATCACATGATGCC
TTTAGATCTGCTTTACCGCGTGGGTTTGCTTTTGAGATACTTTCCGTGTACTCAGGGCCGCCTAATATAGCCTTCAAGTTTAGACA
CTGGGGATACTTTGAAGGAAACTTCAAAGGCCATGCTCCTACTGGAGAAATGGTTCAGTTCCTCGGCCTGGGAGTTCTAAAGGTTG
ATGAACTGCTTAGAGCAGAGGAGATTGAGATTTATTATGATCCAGGAGAGCTGTTCGGGGGACTGCTCAAGGGACCACCTATATCA
GAGACCAAAACCACAGACAGTGGAGACAGCACTGCAGAGAAACAGAGCTGTCCCTTCACACATTAAGAAAACTTAAGGAACTACGA
CTGTTGATTTACTGTATCATTGGGCCATACTGGAAAAATAAGGAAAGCAGAAGTGTGTAGACTCTTTATAAAATATATTGTAATAG
TCACTTGGATGCATGGAATAAGTTATATATTATGTTTTCAAGCGTCAAAATGATAGTACAGATAAATTACAGCAAGAACTAGAATA
AGGCGGTTGATTTTAACTGACCAAAGTCTCAACAGAGCTCAACCGTTGAATCAACTCCGGTTTGGCATTCATCCATGAGAGCCACG
TTCAACATCTCGGTACAGAATTGATCATCAGGTTTCAACCATAAGGCCTTGTGATAATGAGAGATGGCAGCTGAAAAATTTCCCTG
CAAATGGTAAGTGTACGCCAAGCCGGAATAAGTGCTTAAGCTTTTCGTTGATAGTGTAAGTGCTCTTTCATAGTATGAGATAGCTT
CACGGTACTTCCTTAGCTTCCTATATGCATGAGCGAGGTTGACCACAGTTGCTTCCCAGATTTCAGTTAATACAGATGGTATATGA
GCCAACGTCTTCTCAAACCATCGCACAGCTTTACCATACTCTTCCATATGATACGCAACAACTCCGAGTTCATTATAAACAAGTGG
ATCTGAAGGGCATATTGCCTTTGCTTGCATGAAAAACTGGTCCGCAAGCTTGTAGCTATGAGTTCGCATATACTCCATTCCAATGT
ACAGAGTTGGCAAATGACACCCTGGAAATAGCCTAGCTGCAGTGCGATAGGCAGACATCGCTTGGTCACCTTCCTCTTGGGAGGCG
AAGGAATTACCATAGCCTATCCAAGCTGGTGAAAATGAGCCATCTATATTCGTTGCTTTGCTAAAGTACCGCCGAGCTTCAGCATA
CTTTTTGATACTATAGTAGTAACAACCCACCGCAAACCATGACAAAGCCTTTGAAAGGGTAGTCTTTTACCAAATTGCATGCCATT
AGATAGAGCTCATTTGAATTACCAAGCTCCATGGCAGCGGCTAAATGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002887756 cell division cycle family protein [Arabidopsis lyrata subsp. lyrata]12032e-129
NP_565188 anaphase-promoting complex subunit 6 [Arabidopsis thaliana]11933e-128
AAC83033 Similar to CDC16 protein gb|U18291 (CDC16Hs) from Homo sapiens [Arabidopsis thaliana]11933e-128
AAM95623 anaphase promoting complex/cyclosome subunit [Arabidopsis thaliana]11933e-128
NP_565189 pathogenesis-related protein [Arabidopsis thaliana]11719e-126

Swiss-Prot top hits (Blast detail)Scoree value
Q13042 Cell division cycle protein 16 homolog5612e-056
Q8R349 Cell division cycle protein 16 homolog5593e-056
P16273 Pathogen-related protein5584e-056
P41889 Anaphase-promoting complex subunit cut94662e-045
P09798 Anaphase-promoting complex subunit CDC164554e-044

TrEMBL top hits (Blast detail)Scoree value
B3DNN5 At1g7877011932e-128
Q8L5J4 Anaphase promoting complex/cyclosome subunit11932e-128
Q9ZV95 F9K20.19 protein11932e-128
Q8L9B0 Pathogenesis-related protein-like protein11716e-126
A8MS14 Uncharacterized protein At1g78780.411278e-121

Arabidopsis top hits (Blast detail)Scoree value
AT1G78770.1 cell division cycle family protein11947e-131
AT1G78780.2 pathogenesis-related family protein11722e-128
AT1G78780.4 pathogenesis-related family protein11427e-125
AT1G78780.1 pathogenesis-related family protein8821e-094
AT1G78780.3 pathogenesis-related family protein8821e-094

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
64  14%
 
107  25%
 
127  25%
 
81  4%
 
115  18%
 
92  7%
 
72  7%

Unigene MembersMember information