Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13392

FASTA Sequence
Unigene ID: UN13392Length: 1628  SNP
GCATTGATGTGAGTGATGCTGTTGGTTCCAACATCCGTGTTGATAGTAGAGGACCTGAGGTGATGCGTATCATTCCACGTCTTAAT
GAGGATATAAACGAAGAGTGGATATCTGACAAAACCCGATTCAGCTATGACGGTCTGAAAAGGCAAAGGCTGAGCGACCCTATGAT
TCGAGATTCAGATGGACGATTCAAGGCGGTGAGCTGGCGTGATGCCTTGGCCGTTGTGGGTGATATCATCCATCAGGTGAAGTCAG
ATGAGATTGTTGGAATAGCAGGTCAGCTATCCGATGCTGAATCCATGATGGTATTGAAAGACTTCGTTAACAGAATGGGTTCAGAC
AATGTCTGGTGTGAAGGAACAGCTGTTGGTGTTGATGCTGATCTTAGGTACAGCTATCTAATGAACACTAGCATCAGTGGCCTTGA
GAACGCCGATCTTTTCCTCCTCGTTGGTACCCAGCCTAGAGTTGAAGCTGCAATGGTGAACGCTAGGATCTGCAAGACAGTCCGTG
CATCCAATGCCAAGGTTGCATACATTGGTCCACCTGCAGATTTCAACTACGACTGCAAACACCTCGGGACTGGACCTGATACCCTC
AAGGAAATCGCTGAGGGACGTCACCCGTTCTGCTCTGCTCTCAAGAACGCCAAGAACCCTGCAATCATTGTTGGCGCCGGTCTCTT
CAACAGAACAGACAAAGATGCTATCCTCTCTGCTGTTGAGTCCATTGCACAAGCCAACAATGTCGTCAGACCAGACTGGAACGGTC
TTAACTATCTCCTCCTGTACGCTGCTCAAGCAGCTGCTCTTGATCTTGGTCTCATTCAACAGTCTGCTAAAGCCCTTGAGTCTGCG
AAATTTGTCTACTTGATGGGAGCAGACGATGTAGATGTTGACAAGATTCCTAAAGACGCCTTTGTGGTTTACCAAGGTCACCATGG
AGACAAAGCAGTTTACCGTGCAAACGTAATCCTCCCTGCGTCGGCCTTCACCGAGAAAGAGGGAACCTATGAGAACACAGAAGGAT
TCACCCAACAGACTGTTCCCGCTGTCCCAACGGTTGGTGATGCAAGAGATGACTGGAAGATTGTGAGAGCTTTGTCCGAGGTCTCT
GGTGTGAATCTTCCATACAACTCCATCGAAGGTGTTAGGTCCAGGATCAAGAGCGTCGCACCGAATCTAGTCCACACAGATGAACG
AGAGCCAGCTGCTTTTGGGCCTTCATTGAAGCCTGAGTGCAAGGAGACAATGAGCACAACGCCGTTCAAACCAGTGGTCGAGAACT
TTTACATGACAAACGCCATCACGAGAGCATCAAAGATCATGGCTCAGTGCAGTGCCGTTCTCTTGAAGAAGTGAGAGCTTTTCTCT
GTTTCACTTTTTTTTTTGTTTGCAAAAAATAAAGGCTCTCTTTATTTAAGCCGAGTACTCTTTAATCTTGCGGTGAAACCTATAAA
CAAAATGGCAATAACCACATTGTTAGATGCAAAACTTTGCTGTATTAAATTGGATGTTTTGATTTGTTGCATCTTGTGTTTGTTCT
TTGTAGGGATTTGAATATTCATGTGTACTTTCTCTTTAATGTCATATCATATATGAAGAACGTTTTGGGCATGGCTGCTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002868524 EMB1467 [Arabidopsis lyrata subsp. lyrata]22596e-252
NP_568550 NADH-ubiquinone oxidoreductase subunit [Arabidopsis thaliana]22481e-250
NP_851103 NADH-ubiquinone oxidoreductase subunit [Arabidopsis thaliana]22481e-250
XP_002893561 predicted protein [Arabidopsis lyrata subsp. lyrata]22157e-247
AAM91110 AT4g37510/F6G17_160 [Arabidopsis thaliana]18975e-210

Swiss-Prot top hits (Blast detail)Scoree value
Q9FGI6 NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial22484e-252
Q43644 NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial18273e-203
P0CB68 NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial10423e-112
P28331 NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial10414e-112
P15690 NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial10405e-112

TrEMBL top hits (Blast detail)Scoree value
B9DFQ9 NADH-ubiquinone oxidoreductase 75 kDa subunit22487e-251
Q8L7R7 NADH-ubiquinone oxidoreductase 75 kDa subunit18974e-210
B9H3E2 NADH-ubiquinone oxidoreductase 75 kDa subunit18803e-208
B9GUM3 NADH-ubiquinone oxidoreductase 75 kDa subunit18786e-208
B9T118 NADH-ubiquinone oxidoreductase 75 kDa subunit18761e-207

Arabidopsis top hits (Blast detail)Scoree value
AT5G37510.1 EMB1467 (embryo defective 1467); NADH dehydrogenase (ubiquinone)/ NADH dehydrogenase/ electron carrier/ iron-sulfur cluster binding / oxidoreductase/ oxidoreductase, acting on NADH or NADPH22493e-253
AT5G37510.2 EMB1467 (embryo defective 1467); NADH dehydrogenase (ubiquinone)/ NADH dehydrogenase/ electron carrier/ iron-sulfur cluster binding / oxidoreductase/ oxidoreductase, acting on NADH or NADPH22484e-253

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
63  18%
 
121  6%
 
73  18%
 
104  24%
 
91  6%
 
82  12%
 
191  6%
 
112  12%

Unigene MembersMember information