Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13400

FASTA Sequence
Unigene ID: UN13400Length: 1321 SSRSNP
CAAGCTTTAATTTAGATCCTTCATTTTGCTCCTGCTCTCATCAGTTTTGGTAGGCTAAACTTTCCAATAGAAATGGGTGTATTCCC
TGGATTTGGTGCCTGGATCAATCAGAACAATCAAGAGTCTCCTAATGCCGAGTCCAAGAGATCTGAAAATGTCGAGTCCAAGTCGG
CGTCAGAGAAAGACACTAATAATGCTCATTTTAAGAAGAAGAAGAAGGATGTGATATATTATGATTATAGAGATTCGATCAGACAA
CAAGGGCTTTGGTATGAAGCAGAGAAGAAGCATCCGTGGCATAATCCCCGTCCCAAGATCAAGGTGACAAATAAAAAGGGTCTTTA
CCATATGAACATAGAATTGACCGTGGGAACAGCTCCTGATACACTCTATGGATTGATGATTGAACCAAAAGGCGGTCCGTTTTTCG
ATTATGATAAGTGGCGCGACCTAATGAGAAACACATCAAGAAAGGTTTTGAAGGAGAATGGTCCGAGGCGGGACATCATGGTGGAG
AAAGCTGTAGCTTATAAATTCCTTTCGCTGACGACTATATCCATCCCGATACATCTAACTATGGTAGAAAACAGAAAAGATCTTAC
GACAAAATATAAGAAAGGGAAAGTAATGTTGATGAAAGAGTTCCACGGCAACTATAAAGTGGAGCCTATATATGTAGATCAAGAAC
GGCTGTGCAAAAAGAAGTCACCAAAGAGTCCAGAAGAATATAAAAAATGTAGTGGTGGCCGAGGAAGGGTTGCGTCAAAGCTTACA
ATAAACCACTACTTCGAGCCATATCCTCCATTTAATATACCGCCGCTTTCTTGGTTCATCCGTGGGATCACCATCGAAACCTCCAA
AAAGCTGCTCAGCGCGCTTCAGGAGATGGCTTCGATTGTACGAAATGCAAAGCCACCCTCAGAAGAAATCATCAAAGCGAGTGAGA
AAGAGATTATTCAATTACATGATTTTTGAAAAATATAGAACTATAGAAGATTGTCGTCAAACATACAAAAGCCGTTTACCGCGTAT
TAGCGATTATCTTGGTATCGACTACGTACCGCAGCTAATATTGTTTTCTGAAGTTGAAACTACTAAAAAATTATTTGTGATTTAAC
ATATCACAAGATGAAGGGCTACATGATACACCTAGGTGAAGACATGAAGAAATAAACATGGAAAGCACTTAGCTTCGTTCAATGAA
CATACGCAATTTCATGTTTGTAAAAAAAAGAGTCTTATACAAATATAAGAACACAAACATATGTAGTGCTAGATTGATTAGTTACT
AATGGGCTTTAGAAAAGTGTCTGGTCCATTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAC98013 Similar to OBP32pep protein gb|U37698 from Arabidopsis thaliana7739e-080
NP_173771 uncharacterized protein [Arabidopsis thaliana]7235e-074
XP_002893302 hypothetical protein ARALYDRAFT_313228 [Arabidopsis lyrata subsp. lyrata]7121e-072
XP_002893290 hypothetical protein ARALYDRAFT_889898 [Arabidopsis lyrata subsp. lyrata]6895e-070
NP_173781 uncharacterized protein [Arabidopsis thaliana]6832e-069

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9ZUD7 F5O8.13 protein7736e-080
Q9ZUD6 At1g235807234e-074
Q9LQC3 F28C11.196912e-070
Q9ZUC6 Expressed protein6832e-069
Q9ZUD4 Expressed protein6795e-069

Arabidopsis top hits (Blast detail)Scoree value
AT1G23580.1 unknown protein7601e-080
AT1G23690.1 unknown protein6839e-072
AT1G23600.1 unknown protein6793e-071
AT1G23640.1 unknown protein5932e-061
AT1G23690.2 unknown protein5833e-060

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
94  15%
 
108  30%
 
114  15%
 
81  4%
 
65  19%
 
122  7%
 
73  11%

Unigene MembersMember information