Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13406

FASTA Sequence
Unigene ID: UN13406Length: 784 SSRSNP
GGGAAAACGTAGAGATCGAGAGAGAGAGAGAGAAGAAGAAGAGAAGTTTGATCTTGTGAGAGAAGGAAGAGAACATGGCTGCTTCA
GTGATGCTTTCATCAGTGACATTGAAACCTGCGGGTTTCACGGTGGAGCCGACGGACGGAGGAACGAACGAATCGAACTCAAAAGC
TTTGCAGAGAGAGAGAGAGATCTTCGTTTAGATCCCCTGGAGGAATCGCGACAATGGCGGAAAAGGCAGTGACCATCAGAACCCGA
AAATTCATGACCAACAGACTTCTCTCAAGGAAGCAGTTCGTTATTGATGTTCTTCACCCTGGAAGAGCCAATGTTTCAAAGGCTGA
GCTGAAGGAGAAGCTAGCAAGGATGTACGAGGTCAAGGACCCAAACGCCATATTTGTTTTCAAATTCAGAACCCATTTTGGAGGTG
GTAAATCATCCGGGTTTGGTTTGATCTATGACAATGTCGAGAGCGCTAAGAAGTTTGAACCCAAGTACAGACTTATCAGGAATGGT
CTTGACACCAAGATCGAGAAATCAAGGAAACAAATTAAGGAAAGGAAGAACCGTGCTAAGAAGATCCGTGGTGTTAAGAAGACCAA
GGCTGGTGATCCCAAGAAGAAGTGAGAGATCACAAGCTAGTATCAGTCATTTTCTGTTCTTCATAATCGAACTTTTATGTTCATCT
TAAAGTTCTTTGTTTGCAATTAGATTTTCTCTGCAACTAAGACATCTAAACATAATCAAAGGTTTTTGTTCAATACTATATTTTAA
GCTCTTCTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002882383 40S ribosomal protein S24 [Arabidopsis lyrata subsp. lyrata]6686e-068
NP_187143 40S ribosomal protein S24-1 [Arabidopsis thaliana]6605e-067
XP_002874417 hypothetical protein ARALYDRAFT_910915 [Arabidopsis lyrata subsp. lyrata]6507e-066
NP_198158 40S ribosomal protein S24-2 [Arabidopsis thaliana]6417e-065
AAM63791 40S ribosomal protein S19-like [Arabidopsis thaliana]6417e-065

Swiss-Prot top hits (Blast detail)Scoree value
Q9SS17 40S ribosomal protein S24-16602e-068
Q8LC83 40S ribosomal protein S24-26413e-066
Q962Q6 40S ribosomal protein S244353e-042
Q56JU9 40S ribosomal protein S244326e-042
Q5RAQ8 40S ribosomal protein S244326e-042

TrEMBL top hits (Blast detail)Scoree value
B7FMK4 40S ribosomal protein S246211e-062
C6TAW2 40S ribosomal protein S246211e-062
B9RWY8 40S ribosomal protein S246192e-062
A9PC05 40S ribosomal protein S246182e-062
B6SIX3 40S ribosomal protein S246182e-062

Arabidopsis top hits (Blast detail)Scoree value
AT3G04920.1 40S ribosomal protein S24 (RPS24A)6612e-069
AT5G28060.1 40S ribosomal protein S24 (RPS24B)6422e-067

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
126  26%
 
114  17%
 
65  22%
 
104  17%
 
72  9%
 
91  4%
 
191  4%

Unigene MembersMember information