Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13408

FASTA Sequence
Unigene ID: UN13408Length: 874 SSRSNP
GGCACCATGAGAAAGGCTCAATGTAAGATTCCTCTCGACTCTTGATGAGCATTTAGTTTGTTTCCAACTTTCCAATAAAGAGATAA
CTTAGGGACTTTGTCTAAATCAAGAAGAAACAAGAACCACAAAATCAAGACAGTCGAGTTTAGTTCCATGAATACTAAAATGTTGA
TAAAGAAAAATATCCTTGAAAAGAGAAACAAAACAGCAGATAACTTCCATCATCAAGATTCTCTATCACCCAAACAAAAAGGTTTT
ATGTGAAGTAGTCGTCGGTCAATCAGAGAGAGAGAGACTGTTTTCACATGAACAAGTTGGGCTTGGAGGCCTTGTAGGTGGTCTTG
AGCTTCCTGGTTGGTGGTCTGACCTTGCGGAACACCAATGGGAACTTGATTTTGCTGTTGTGGAACTGCTTGGTGCTCTCCCTCTT
GCAAAGCTTGGCTGGAACGGTCGCCGTCTTGATGATCTGGATGCAAGGGAACCTGACACGGTGTCTCGACGCCATCTCGGTGTACA
TCTGTTCCACGGCTCCGTTCAAGGTGGTGTCGCGGTACTCCTTGTACATGTTGTGGTATCCAGTCCTGCTCTGGTACCTCAACCAG
ATTCCGAAGTTCTTGATGGTTGTTGGGTTCTTCTCAAAGATCTCGTTGATGGCGAGCATCTGACCATTGCTCTTCTTCACCTTCTT
CAGCTTCCTCAAGAAGTACCAGAACTTGGACTTGGCACGAACCTCGTTCGTGGCCCAGAGCTTCATCCGGTAAATCTTAGGTTGGA
CATCCTTCTCTGTCGGGAGAGCTCTTCCTACAACCTGGTACTGGTGAAACCTGAAAGCGCCCATTTTCGTCGGTAGAAAGAAGAAA
CCTAAACAGATGCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_180995 60S ribosomal protein L18a-2 [Arabidopsis thaliana]9357e-099
XP_002882886 60S ribosomal protein L18A [Arabidopsis lyrata subsp. lyrata]9017e-095
XP_002317384 predicted protein [Populus trichocarpa]8953e-094
ABK93213 unknown [Populus trichocarpa]8927e-094
NP_188078 60S ribosomal protein L18a-3 [Arabidopsis thaliana]8882e-093

Swiss-Prot top hits (Blast detail)Scoree value
P51418 60S ribosomal protein L18a-29353e-100
Q9LUD4 60S ribosomal protein L18a-38889e-095
Q943F3 60S ribosomal protein L18a8682e-092
Q9ATF5 60S ribosomal protein L18a8646e-092
Q54MK8 60S ribosomal protein L18a4892e-048

TrEMBL top hits (Blast detail)Scoree value
A9PBF7 Predicted protein8952e-094
A9PA10 Putative uncharacterized protein8925e-094
C6SZ28 Putative uncharacterized protein8872e-093
Q8L7K0 60S ribosomal protein L18A, putative8862e-093
A9P8L2 Predicted protein8853e-093

Arabidopsis top hits (Blast detail)Scoree value
AT2G34480.1 60S ribosomal protein L18A (RPL18aB)9362e-101
AT3G14600.1 60S ribosomal protein L18A (RPL18aC)8897e-096
AT1G29965.1 60S ribosomal protein L18A (RPL18aA)8871e-095
AT1G29970.2 RPL18AA (60S RIBOSOMAL PROTEIN L18A-1); structural constituent of ribosome8772e-094

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1111  28%
 
87  18%
 
191  3%
 
95  13%
 
125  13%
 
711  28%

Unigene MembersMember information