Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13416

FASTA Sequence
Unigene ID: UN13416Length: 1303 SSRSNP
TTTTTAACATAATTTCGATAAAAAATTTCTTTTTCATTTATATATATTTCTCTATATCTCAGATCTTCTGGACCCTCTTCTCTTTT
CCACTGATCTCTGAATCATATATAAAACAAGTATTCTTCTCTTGAATAATCGTCACTAGAGTCCATATATGGACCAAGATGACCAG
AAAGAAGAACCAGAAACGGTGTCATTCGGCAACAGCAAGTGCAAGAGCAAGATTGCTCCCGGAGATGATCACGATGGAGACGAAAG
CAGCGGTGCTAAGAAAATAAAGAAGAAGAAGAAGAAGAAACCGCAAAAGACAAGAAAACGAGGAGAGCTAATGTCGTTTAGCGAGC
TTCCGGAGTACATGAAGGATAACGAATATATATTGAATTATTACAGAGCTGAATGGTCTATCAGAGATGCTTTCTTCAGCGTCTTC
AGTTTCCACAATGAGTCCCTCAACGTTTGGACGCATTTAATTGGTTTCATCTTATTTGTGGGACTAACCGTCGCCAACATTATGCA
TCACGATAAATTCTTCCCCGTGGATGCAAAGAATCCAGGGAATGCAGCAAGATGGCCATTCTTCGTCTTCTTAGGGGGCTCAATGT
TCTGCCTACTCTCGAGCAGCATTTGCCACCTCTTCTGCTGCCACTCCCATGACCTTAACGTCTTCCTCCTCCGCATAGACTATGCT
GGTATCACCGCCATGATCATCACATCTTTCTTCCCACCAATCTACTACATCTTCCAGTGCACTCCTCGTTGGTACTTCATCTACCT
TGCGGCCATCACCTCTATGGGAATCTTCACGATCATCACACTCTTCACTCCATCACTTTCCTCTCCCAAGTACCGAGGTTTCCGTG
CTTTACTCTTTGCCTCCATGGGGCTCTTCGGAATCGTGCCAGCTATCCATGCGCTTGTGGTCAACTGGGGAAACCCGCAAAGGAAC
GTGACGCTCTTGTACGAGCTGGGCATGGCAGTGTTTTATCTTGTTGGGACCGGGTTCTATGTAGGGAGAGTGCCTGAGAGGCTTAA
ACCGGGATGGTTTGATCGTGTGGGGCATAGTCATCAGATCTTCCATGTGTTTGTTTTGTTGGGTGCTTTGTCTCACTATGCAGCTG
CTCTCTTGTTCTTGGATTGGCGTGACCATGTTGGTTGTTAAACATTTATTTTTGTAATTATTTTGAAGATCAAAAACAAAATTAAT
TTGTCTGTATCACGTGGAAAATGTAATAATTCCATTTGTTGTTTAAATTGAATTGTAACTCCATTTGTGGTATTTATATATAATAT
GGTTTTATATACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33817 unnamed protein product [Thellungiella halophila]16511e-181
NP_197527 heptahelical transmembrane protein1 [Arabidopsis thaliana]15758e-173
XP_002873987 hypothetical protein ARALYDRAFT_326421 [Arabidopsis lyrata subsp. lyrata]13581e-147
XP_002331026 predicted protein [Populus trichocarpa]10972e-117
XP_002963772 hypothetical protein SELMODRAFT_79950 [Selaginella moellendorffii]8472e-088

Swiss-Prot top hits (Blast detail)Scoree value
Q96A54 Adiponectin receptor protein 14472e-043
Q91VH1 Adiponectin receptor protein 14472e-043
Q8BQS5 Adiponectin receptor protein 24331e-041
Q86V24 Adiponectin receptor protein 24321e-041
Q09749 ADIPOR-like receptor spbc12c2.09c4222e-040

TrEMBL top hits (Blast detail)Scoree value
Q93ZH9 AT5g20270/F5O24_16015756e-173
B9N724 Predicted protein10972e-117
A4Q7N1 Hly-III related proteins8282e-086
B9IMT2 Predicted protein8103e-084
A5B2T0 Putative uncharacterized protein8085e-084

Arabidopsis top hits (Blast detail)Scoree value
AT5G20270.1 HHP1 (HEPTAHELICAL TRANSMEMBRANE PROTEIN1); receptor15871e-176
AT4G30850.1 HHP2 (HEPTAHELICAL TRANSMEMBRANE PROTEIN2); receptor5852e-060
AT4G30850.2 HHP2 (HEPTAHELICAL TRANSMEMBRANE PROTEIN2); receptor5852e-060
AT2G24150.1 HHP3 (heptahelical protein 3); receptor5611e-057
AT4G37680.1 HHP4 (heptahelical protein 4); receptor5583e-057

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
102  14%
 
62  14%
 
82  14%
 
124  29%
 
112  14%
 
91  7%
 
71  7%

Unigene MembersMember information