Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13420

FASTA Sequence
Unigene ID: UN13420Length: 1155  SNP
GAGAAACAAGAAGCTCTGTCTATTGTGTCCTTGTTCACGTTTTCTTTTCTCGCTCAACAATAGTCTAAAAACGAAGACATTGGGGA
AACAAATATAAAATAAACAATTGAACATTACATCATAAGTATAAATCATTACAGCACACTGTAACTCTAACGACACAATCACCTTA
TATAATATAGACTGTCAGTTCTTGAACTCACTCTCACAATTCTCCGACACAATCTCAACCTTCTTGGCATCTAATAATCCCTTAAC
CTTAACATCACAAGTCACCACCACTTCCCTGTTCTTTTTCACTGGTCCTGCTTCATAGTCCGCCTTTAGCTCCATAATCAGCACCA
AACTCACCGGTTGTTTCGATCCCCGAGGTGGCATAACGGCGTTCTTGGTCGACCCACTGAGCTTTACATTGACGTTGCTGGATCCA
GTCGCCGCCAGGGACATCTTTGGGAATTTTCCGCGTCCTAGGCTCTTGTTCTTGTACGTTAATGAAATCATACTGTTTCTTCCCAT
CGTATAGCTTACCCCCATGTTAGACGTCGGATTCTCAGCTCTCAACGTGATTTCGATATTACTAGGTTTTGCCGTTAATCTCTCGA
CTTCAAAAAGTGGAAGAGTGGGGTTGAACACGAAATGAAGGATAACGGTGATTGCACCAATTATGAATCCAAAAAAGATCAAGATA
ATAAAGAACCACATAAGACGTTTGGAACACCCATTCCTTTTGTTTTTCTCCGGGTTGTTACGGCGTTCTTGGACGTATTTTGCGTG
TTCAGGAGGAGGAGTCCAATAGACTTGATCTCTCGGTACCTGGACAACGTAAGTCTCTAGCTCAGGGATTGAATGGGGAGGAGGGA
GAGACCGGGAAGGTGTGGCCAGGATTGGAGAGAGATTAAGAGAATGATTACGCCAATGGTGTGGTGGAGGATCTTGAGAGGGCAAT
GCGGAGAGACTAGAGGTTGGACGGTGCCAGGCGGAAGGAGGATCGTCGGATTTGTCATCGTCGGATTCATGGAAGGTGGCGGAAGG
AGGAAGCCGTGGCCCCTCCATCGGAGAAAGGTGGGAGTTACAGGATGTGTGGTGGAGGTTGGCTTAGAGGGATCACGAAAGAGAGA
GAATTGAGAGATGATGCGAAAATTAGGGTGTGCATCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002878602 hypothetical protein ARALYDRAFT_900669 [Arabidopsis lyrata subsp. lyrata]12316e-133
NP_179808 hydroxyproline-rich glycoprotein-like protein [Arabidopsis thaliana]12235e-132
ABK28506 unknown [Arabidopsis thaliana]12235e-132
XP_002866881 hypothetical protein ARALYDRAFT_490757 [Arabidopsis lyrata subsp. lyrata]3589e-032
NP_680775 hydroxyproline-rich glycoprotein family protein [Arabidopsis thaliana]3543e-031

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
A0MEP1 Putative uncharacterized protein (Fragment)12233e-132
Q9SIE6 Hydroxyproline-rich glycoprotein family protein12233e-132
Q3E7T6 Putative uncharacterized protein At4g39745.13542e-031
B9H541 Predicted protein3362e-029
B9T4H5 Putative uncharacterized protein2475e-019

Arabidopsis top hits (Blast detail)Scoree value
AT2G22180.1 hydroxyproline-rich glycoprotein family protein12241e-134
AT4G39745.1 hydroxyproline-rich glycoprotein family protein3541e-033
AT2G27080.1 harpin-induced protein-related / HIN1-related / harpin-responsive protein-related1702e-012
AT2G27080.2 harpin-induced protein-related / HIN1-related / harpin-responsive protein-related1702e-012
AT5G21130.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: harpin-induced protein-related / HIN1-related / harpin-responsive protein-related (TAIR:AT2G27080.2); Has 592 Blast hits to 591 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 592; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).1523e-010

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
92  14%
 
72  14%
 
102  14%
 
83  21%
 
62  14%
 
123  21%

Unigene MembersMember information