Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13424

FASTA Sequence
Unigene ID: UN13424Length: 1232 SSRSNP
GGGAGCCACATCCCTTCTCTCTCTCTCTAACTCTGTGGAAGCTACATAAGTATATACCACATAAAAAATAAACAATGTCGACAGAC
TTGACGGAGGAGGAGTCGTTGTCCGGCAAGGATTACAAGGATCCACCGCGTGTCAAGATTTTCGAGGCGAGGGAGCTAGGAAAATG
GTCCTTCTATAGAGCAGTCATCGCTGAGTTCATAGCTACTCTTCTCTTTCTATACATCACCGTCTTGACAGTCATCGGTTTCAAGA
GCCAGACGGATCTCAAAACTGGCGGTGGAGCCTGCGCCAGCGTCGGCCTCCTGGGCATCTCTTGGGCCTTCGGTGGCATGATCTTC
ATCCTTGTCTACTGCACTGCCGGCATCTCTGGTGGGCACATTAACCCTGCAGTGACGTTTGGACTATTCTTGGCTAGCAAGGTGTC
GTTGGTGAGAGCTATATCCTACATAGTGGCCCAGTGTCTCGGAGCCACTTGCGGAGTTGGTTTGGTGAAAGTCTTCCAGAAAACTT
ATTACAACCGATATGGCGGTGGAGCCAACGTCCTCGCCGACGGATACAACGTTGGTGTTGGTGTTGGTGCTGAGATTATCGGCACA
TTTGTCCTTGTCTACACGGTCTTCTCCGCTACAGACCCTAAGCGTAATGCCCGTGACTCTCACATTCCTGTATTGGCACCATTGCC
AATTGGATTTTCGGTGTTCATGGTTCATTTAGCCACAATCCCAATCACTGGAACTGGAATTAACCCGGCTAGGAGTTTTGGAGCTG
CAGTCATCTACAACAATCAAAAGGCTTGGGATGATCAATGGATCTTCTGGGTCGGTCCATTTGTGGGAGCAGCAATTGCAGCTTTG
TACCACCAGTTTGTGTTGAGAGCTGGTGCTATGAGGGCTTATGGGTCAGTCAGGAGCCAGCTTCACGAGCTTCACGCTTAGAATTT
GTTTTTTTCAAAACTATCTAAGAGGTGGAGATTTCTTTGGGCCAGGAGGAAGGGAAAAAAAATATCAAAATAATAATTAAAAAGAA
TTTATTGGTGAGTAACATTTAGTGTATTATTTGTTGCTTTGAGGGGGAGGTTTGAGAGTGACTTTATATACCAGTTTGCTGTATCC
AAGCTTGTAGAATGTATGTTTCTATTTGATGTATTTGTTATATATATTCTGTACTTATCAATCCTTCTATTTGTTGAATGATGTTT
CATAATTATAAATTATTTACTTCTTTTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABL97985 water channel protein [Brassica rapa]14825e-162
BAJ34489 unnamed protein product [Thellungiella halophila]14243e-155
NP_181434 putative aquaporin PIP2-6 [Arabidopsis thaliana]14101e-153
XP_002879778 PIP2_6/PIP2E [Arabidopsis lyrata subsp. lyrata]14029e-153
AAC17529 aquaporin 2 [Samanea saman]12074e-130

Swiss-Prot top hits (Blast detail)Scoree value
Q9ZV07 Probable aquaporin PIP2-614105e-155
P43287 Aquaporin PIP2-211694e-127
Q9SV31 Probable aquaporin PIP2-511623e-126
Q9FF53 Probable aquaporin PIP2-411542e-125
P30302 Aquaporin PIP2-311462e-124

TrEMBL top hits (Blast detail)Scoree value
A1YMX9 Water channel protein14823e-162
O65357 Aquaporin 212073e-130
A8SJR3 Putative aquaporin PIP2;312054e-130
C6TJQ0 Putative uncharacterized protein12011e-129
C6TEH7 Putative uncharacterized protein11992e-129

Arabidopsis top hits (Blast detail)Scoree value
AT2G39010.1 PIP2E (PLASMA MEMBRANE INTRINSIC PROTEIN 2E); water channel14113e-156
AT2G37170.1 PIP2B (PLASMA MEMBRANE INTRINSIC PROTEIN 2); water channel11694e-128
AT3G54820.1 PIP2;5 (PLASMA MEMBRANE INTRINSIC PROTEIN 2;5); water channel11622e-127
AT5G60660.1 PIP2;4 (PLASMA MEMBRANE INTRINSIC PROTEIN 2;4); water channel11542e-126
AT2G37180.1 RD28 (RESPONSIVE TO DESICCATION 28); water channel11462e-125

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
103  19%
 
85  31%
 
73  19%
 
122  13%
 
211  6%
 
92  13%

Unigene MembersMember information