Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13466

FASTA Sequence
Unigene ID: UN13466Length: 1802  SNP
GGGCCCACGATAAATAGATAACACTCTCGAATCGTTCCTCGTGGGTCACTTTATTAAACTAATAACTAGGATCGAAGAGAGAAAAA
CTTCACTAATCTTTCCGACACATCGGAGAGACAGATCAACGAACGTTTTGAATACGCGGGAAAATCATCGGGAGAAGACAATGGAT
CGTTGTCTTATCTCGACCTTACTTCTTCTGGTGGCGTTAACCATATCACCGAGGAGCCACGGCTTTCTTAAGACCGAGAATCAGAA
GATAAAGTCTGCAACTTTCTTGTCACCAAAGCTAGTGATGCATCCAGGATCAGTCGCCAATCCATTCCTCTTCGACGTCGATTTCC
CCAGAGGTCACATCGGCATCAAATCCTTCGACGCCGAAGTCGTCGACCAAGAAGGCAACCCCGTCCCCCTCCACGAAACCTATCTC
CACCACTGGGTCGTCCAGCCTTACTACGTACGCAAAGGTTTCAACCTCTCTCACCGAGACATGCCTAGGAACCACGGGTTCTCCAG
GCATCTCGCTGGTTCTGGTTCGAGTCTCCCCGATTACATCCTCGTTAAGAACGGAGGGCTGTGCAGGAACACGGTCAGGCATTTCT
TCGGGTTAGGATCAGAGACACGCAAGACCTCGACGCGTGTCCCTGATCCTTACGCGATCGAGATCGATAATCCGGAGGAAAGACCT
GATGGTTACGAGTTCAAATGGCTTCTCAACATCCACGCGATTGACACGAGGGGTGTTGTGGATAGATCGGGATGCACGGAGTGTCG
TTGTGATCTGTATAATGTAACCATCGACGAGTACGGTCGAGCTATAAAACCGGATTACAAAGGTGGTTTGTACTGCTGCTACGATA
AGACTCAGTGTCTTGTGAGAAACGGGTTTGATAATGTGGAGGAGAAGACGAGAACTCTGTATCTTAAGTATACCGTGAGATGGGTT
GATTGGGACAGCTCGGTGGTGGTGCCCGCTAAGGTTTATATCCTCGATGTTACGGATTCTTGGGAACGTTCGGAAGGTTCAACAGG
AGATAGCCAAGAACATTTTTGCCATGTGGAATACGAGGTGAAGCCGTGCAAAAAAACCAATGGCGATGGATGTGTTGACGTCAAGA
AGAAGAGCTTAATGATGCCGTTTAACGGGTATATTGTCTACGGAGCAGCTCACCAGCACGCCGGTGGTATCGGTGCTGCTCTATAC
CGAGAGGACGGTGAGGGGATTTGCACTTCGACGCCAAAGTATGGGAATGGAGACGAGCCTGGGAACGAAGCTGGTTATATTGTTGG
AATGTCGTCTTGTTATCCTGAAGCACCGGTGAAAGTGAGTTATGGAGAGACACTGACTTTGGAGTTCAATTACAGTAGCGCCGTTG
GTCATACCGGTGTTATGGGACTCTTTTACATGCTGGTTGCTCAGCAGCTGCCTGAACCGGAGAGCTCCTTGCCTGCACTTTTCCAG
GCACATGCGAAAAGCGTGAGCCTTTTAACCTTTCTGGCAGTGACGGTGGTGGTGGCGGTTGTGGTTCTAATAGCCGCCGTGGTATA
CCGGAGACAGAACAGGGAAGATGGTTACCAATCACTTAGCACCTAAAGAGTAAAACTATAGTGTTCTGTTTTTGTTTTATCTTCTT
GTATACAAAAGAATCAAAATAAAAAGAATATGTTGTCCGCTTACTCTAATCAATGTGATATTTTGGTGATGGTGCTTACGTGTAAG
AAATTTTCTGTAATGGGTCACACGATACGCAATGGTCTATGGACCTGGAAAGTTATAACAACTCTTTCTATATTCGTTACTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33779 unnamed protein product [Thellungiella halophila]21055e-234
XP_002866457 hypothetical protein ARALYDRAFT_496351 [Arabidopsis lyrata subsp. lyrata]19666e-218
NP_200990 uncharacterized protein [Arabidopsis thaliana]19504e-216
AAL91170 putative protein [Arabidopsis thaliana]19496e-216
BAB10082 MtN19-like protein [Arabidopsis thaliana]18018e-199

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8VZ21 Putative uncharacterized protein At5g6182019503e-216
Q8RXF7 Putative uncharacterized protein At5g6182019494e-216
Q9FLS7 MtN19-like protein18016e-199
B9ICC3 Predicted protein10382e-110
B9RA49 Putative uncharacterized protein10247e-109

Arabidopsis top hits (Blast detail)Scoree value
AT5G61820.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Stress up-regulated Nod 19 (InterPro:IPR011692); Has 27 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).19511e-218

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  7%
 
113  21%
 
123  21%
 
181  7%
 
211  7%
 
94  29%
 
81  7%

Unigene MembersMember information