Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13478

FASTA Sequence
Unigene ID: UN13478Length: 1452 SSRSNP
GGATCTTCTTCGCGTCGATCTCTCTCTCTCTCTCTGCTTGGATATTTTCTCTCCAGATCTCTCTCTCCCGTGTCAAATCTTCGAGA
TCTGAATATCTCCTCCTGAATCCTGAAGGGGGAAGGATGTACGGATTCGAGGCGCTTACCTTCAACATCCATGGCGGATACCTGGA
GGCGATCGTGAGGGGCCACCGTGCCGGCCTTCTCACCACCGCCGATTACAACAATCTGTGCCAATGTGAAAACCTAGACGACATCA
AAATGCACCTCTCCGCCACCAAATACGGCTCTTACCTCCAGAATGAACCGTCACCTCTTCATACGACCACAATCGTGGAGAAGTGT
ACGCTCAAGCTTGTGGATGATTACAAGCATATGCTTTGCCAAGCTACTGAGCCTATGTCCACCTTCTTAGAGTACATCAGATACGG
CCACATGATTGACAATGTGGTGCTGATTGTTACTGGAACTTTGCACGAGAGAGATGTTCAAGAGTTGATTGAGAAATGTCACCCTT
TAGGCATGTTTGACAGCATTGCCACGCTGGCTGTTGCTCAGAACATGAGGGAGCTCTATAGGTTGGTGCTTGTTGATACTCCTCTC
GCTCCATATTTTTCTGAGTGCTTGACATCTGAGGATTTGGATGACATGAACATAGAGATTATGAGGAACACCCTCTACAAAGCATA
CCTTGAGGATTTTTACAAGTTTTGTCAGAAACTTGGAGGGGCAACATCAGAGATAATGTCCGACCTTCTGGCCTTCGAAGCTGACA
GAAGAGCTGTGAACATCACCATCAATAGCATTGGGACTGAGCTAACAAGAGAAGACAGGAAGAAACTGTACTCCAACTTTGGTCTC
CTCTATCCATATGGTCACGAGGAGCTTGCTATCTGCGAAGACATAGATCAGGTTCGTGGTGTTATGGAGAAGTACCCTCCTTACCA
AGCAATATTCTCAAAGATGTCTTATGGAGAGAGCCAGATGCTTGACAAAGCATTTTATGAAGAAGAAAGTCAGAAGGCTTTGCTTA
GCCTTTGAGCAGCAGTTCCATTACGGGGTGTTCTTTGCGTACATGAGATTGAGGGAGCAGGAGATCAGGAACCTGATGTGGATATC
CGAGTGTGTTGCACAGAACCAGAAGTCGAGGATCCACGACAGTGTGGTCTACATGTTCTGAGTCCGGTAAGAAGTGAGAAAAAGCA
CATTAAAATGTGTAAATGTGTTTTTAACATTGGAGAACAAGAAGAAAGAACCTATTTGATTGCTGTTGGTTTTCTTCATTGCTCCG
ATTTGCCAGAGAAATCTGCGGTTTTTACATTTGACTGTGTACCCAAATCAGAATCTCTCCAATTTGTTTGTTTTGGCCATATCTTG
TTTGGTTCTCTATATTTACCAATAAAACTCTTGTAATAATATCAAACTACTTATTTATCATGGGTTTTTCTTGCCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_189512 V-type proton ATPase subunit d1 [Arabidopsis thaliana]15632e-171
AAG40030 AT3g28710 [Arabidopsis thaliana]15597e-171
NP_189513 V-type proton ATPase subunit d2 [Arabidopsis thaliana]15533e-170
ABN08957 H+-transporting two-sector ATPase, C (AC39) subunit [Medicago truncatula]15005e-164
XP_002282568 PREDICTED: hypothetical protein [Vitis vinifera]14952e-163

Swiss-Prot top hits (Blast detail)Scoree value
Q9LJI5 V-type proton ATPase subunit d115631e-172
Q9LHA4 V-type proton ATPase subunit d215531e-171
Q8RU33 Probable V-type proton ATPase subunit d14563e-160
P54641 V-type proton ATPase subunit d9752e-104
Q9W4P5 V-type proton ATPase subunit d 18542e-090

TrEMBL top hits (Blast detail)Scoree value
Q9FE04 AT3g2871015595e-171
A2Q5T7 H+-transporting two-sector ATPase, C (AC39) subunit15003e-164
A5ACR7 Putative uncharacterized protein14951e-163
B6VAX6 Vacuolar ATPase subunit d14951e-163
B7FIK1 Putative uncharacterized protein14905e-163

Arabidopsis top hits (Blast detail)Scoree value
AT3G28710.1 H+-transporting two-sector ATPase, putative15639e-174
AT3G28715.1 H+-transporting two-sector ATPase, putative15531e-172

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
62  7%
 
82  7%
 
113  11%
 
203  11%
 
216  22%
 
103  11%
 
181  4%
 
94  15%
 
191  4%
 
72  7%

Unigene MembersMember information