Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13499

FASTA Sequence
Unigene ID: UN13499Length: 1028 SSRSNP
GGGTCAAAGGTCTCTCTTCTCCTGCACATTAATCAAAGACACTCTCTCTCTCTCATCAATGTTCCTTTGAGACCAATGCTCCTCCT
TTTCTTCTTCATATAAACCACATATCCTCTCCTCCATATCTTAACAATTTCATAGCAAACCCTAAAACTGAGTAATAGAGAGAGCT
TGAGAGAGAGAGAGAGAGATGGGTAGAGGGAAGATAGAGATAAAGAGGATAGAAAACGCAAACAACAGAGTGGTGACGTTCTCAAA
GAGGAGGAATGGGTTGGTGAAGAAGGCCAAAGAGATCACTGTTCTTTGCGATGCAAAAGTTGCTCTCATAGTCTTTGCAAGTAATG
GTAAGATGACTGATTATTGTTGTCCTTCCATGGATCTTGGTGCTATGCTGGACCAATACCAGAAGTTATCTGGCAAAAAACTATGG
GATGCTAAGCATGAGAACCTCAGCAATGAGATTGATAGGATCAAGAAAGAGAATGATAACTTGCAACTTGAGCTCAGGCACTTGAA
GGGGGAAGATATACAGTCTCTCAACTTAAAAAACCTGATGGCCGTAGAGCATGCCATTGAACACGGCCTAGACAAAGTCCGAGACC
ACCAGATGGAGTACCTCATGACAAAAAGGAGAAATGAGAAAATGTTGGCGGAGGAGAATAGGCAACTCAGTTTCCAGCTGCAACAA
CAGGAGATGGCTATAGCTAGCAACGCAAGAGGAATGATGATGAGGGATCACGATGGACAATTTGGATATAGAGTCCAGCCGATTCA
GCCAAATCTTCAGGAAAAGATTATGTCTTTGGTCATCGATTGATCATCGAGATTTGTAATCTCATCACCAATCTACTATCTATTCC
CTTTGTCTTTATGAATGTGTGTGTCTCCTTTCAATCTCGAGCCGCCTATGTACTCCCTTTACGACACTTACTTAAGCTTATATGTG
TGTTGTTTGCTTATGAAAACTCTATGTATGTGTTGTTTGCTTAATTAAACGTTTGAAACTTTATTGCATGTGTGTGGAAACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAY63867 PISTILLATA [Brassica juncea]10622e-113
ABW74344 PISTILLATA-2 [Brassica napus]10585e-113
ABW74343 PISTILLATA-1 [Brassica napus]10452e-111
NP_197524 Floral homeotic protein PISTILLATA [Arabidopsis thaliana]10272e-109
AAD51995 floral homeotic protein PI [Arabidopsis thaliana]10254e-109

Swiss-Prot top hits (Blast detail)Scoree value
P48007 Floral homeotic protein PISTILLATA10279e-111
Q07474 Floral homeotic protein PMADS 25941e-060
Q03416 Floral homeotic protein GLOBOSA5743e-058
Q40702 MADS-box transcription factor 25709e-058
Q03378 Floral homeotic protein GLOBOSA5611e-056

TrEMBL top hits (Blast detail)Scoree value
Q4PRG6 PISTILLATA10621e-113
A8V347 PISTILLATA-210584e-113
A8V345 PISTILLATA-110451e-111
Q9SEF9 Pistillata10154e-108
C1IDW5 PISTILLATA-like protein (Fragment)9562e-101

Arabidopsis top hits (Blast detail)Scoree value
AT5G20240.1 PI (PISTILLATA); DNA binding / transcription factor10286e-112
AT5G23260.1 TT16 (TRANSPARENT TESTA16); transcription factor3305e-031
AT5G23260.2 TT16 (TRANSPARENT TESTA16); transcription factor3262e-030
AT5G23260.3 TT16 (TRANSPARENT TESTA16); transcription factor3127e-029
AT3G54340.1 AP3 (APETALA 3); DNA binding / transcription factor3063e-028

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1110  22%
 
65  11%
 
1211  24%
 
87  15%
 
102  4%
 
710  22%
 
91  2%

Unigene MembersMember information