Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13503

FASTA Sequence
Unigene ID: UN13503Length: 6364  SNP
GGTATATGCGTGATACACAATCTATTAATTATAATTAATTTTATTTCAATACCATTTTTTTAATCCTATCCTATACTAACTATCAA
TATTTAGGTCTTATAATACCTCAGGAGCTAATGAAACTATTTTAGTAAAGTTTAATTGTCTCAATTCCCGTGGGATCGCCCCAAAA
ACGCGAGTTCCTTTTGGATTTCCTTCTTGATCAATGACAACTGCGGCATTGTCGTCATATCGTATTATCGTCCCATTCTTACGTTT
GAGTTCTTTACAAGTACGTACAATTACAGCTCTGATCACTTCTGATCTTTCGAGAGGAGTATTTGGGATTGCTTCCTTGATTACAG
CAACAATAACGTCACCAATATGAGCATAGCGGCGATTACTAGCTCCTATTATTCGAATACACATCAATTTTCGAGCCCCGCTGTTG
TCTGCTACATTCAAATAGGTTTGTGGTTGAATCATATTTTTGTATCTCTTCTTTTAGTGCAAAGGACGAAGTAAAAAAATATTGTT
TGTCAAAAAAAAAACTTATAATCTTTTTATCCTTAAATGTTATTTAGCTTTTTCATTCTATATTCCTATTCACAAATAATGAATTG
GGTTTTTATAGGCATTTTTGATGCCGCTATTGAAATAGCTTTTCTGGCTATATTTTCTGGTACACCACCCATTTCATAAAGGATTT
TACCTGGTTTAACCACAGCTACCCAGTACTCTGGGGATCCTTTCCCAGAACCCATACGCGTTTCCGCGGGTCTTACTGTAACTGGC
TTGTCTGGAAATATACGTACCCAAATTTTTCCACCACGTCGTATATTTCGTATCATTGCTCGTCGCCCTGCTTCTATTTGTCTAGA
TGTAATCCAAGCGGGTTCAAGTGTTTGAAGAGCATATCTGCCAAAACAAATACGATTCCCACGAGAGGATATTCCTTTTAGTCTTC
CTCGGTGTTGTTTACGAAATTTGGTTCTTTTTGGGTTATAGTTGATGGGTTTTTTCTAAATGAGAAATTCCATCTCTACTGCAGAA
CTGGACGTGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAAAAGGATTAATTAAGATATAGATGTAGTTAATGATTAATCCTATT
AATCATGGTATTTTTTTTTATTTCATCTTATCTCTTCTAAATTTGTGTATGTCTTTTTTTAAATAGAATCAAAGATCAATTTTATT
TCGATTTATTTAAAAATAACGTAATATCATCATTACAAATGTAATTTTTGTTAGAGTTAGAATATTATAACAAATCCTTATTTTAT
TTTTTTCATTGTTTTTTTCATCTTTTATTACTTTTTTTATTTGAAAAAAAAACCAATTTTTCGCCGGCGAATATTTACTCTTTCAA
TATCTATTTAAGTTTGCTGTTTATACCCCGAGGTCTCAGAATCAAAATCAGAAATCAGAATAGATAATAAAGTTTCTGGTTTATTC
CGCCATCCTGTCCAATGAATTACTAAGATTTCTTGTTCACTAGAATCCTATATATTCATGGGTTCCGTCGTTCCCATCGCTTCTTG
ATTAATCATTAGGCCTGAATTCTACAATGGAGCTTTTACATGAAATTTTGAATTTCATTTTTTTTTTTGAGGCAATTTTCTCAGTT
TTTATTGGCTCAAGGCTCTTAATTTTTTGTTTTCGGAACAGATTTATCTAATTATTATGAATGAATCTGTATTGATGCTTTATTAC
ATTGCTTTTCTTACAGTGACCTCATAGATTTTCCAAATTGGAATCATATATCATTAATATTCAATTTTTTCGCTCTTTCTTTCATC
CTTCCATTTATCCGCATACTTTTTGATTACCTTTCATAACTTAATAATCATCTTTCTTTATTCTTTTTTTTTTTTAGTCAGTTGCT
CCAATGATATGATCAGCCTATCATATCTTGACTAATTTTTTGGATCCAGATAATGCGAAGCAATGAGTTGCTTAGGTTATTTATTA
ATGCTGTAGTTATTAGTTGCTCTTATAGGTAAGTTCTTTTTTTTTTATCGTAATCTAACCCTAAACCAACGAGTCACACACTAAGC
ATAGCAATTATATCAAAGGAGTTTTGATGGAAATGTTTATTCAACCTTATAGAATTGCTTATTTTTTTTCTTAAACATAAAAAAGA
AGACTACAAGTTTTTATTTTTATTTCTTTTTTTATTTCTTTATAGTGTTATACTATATAGTTTTCGTTTTTTATCATTGGATAAAA
TGTAAAGACAAATAAAGTTTTTTTATTCTTCGTCTACGAATATCCAAATTTTTATTCCTAAAACCCCATAAATAGTTCGAACTGTA
TAGGAACAATAATCAATTTTAGCTTCAATTGTTTGTAAAGGAACTCTGCCTTCTCTGATCCATTCAACACGTGCAATTTCTTTTCC
GTCGATACGTCCTGCAATTTGTACTTGAATTCCTTTTGTATTCGCCTGTTCAGTTAATTCAATAGCTTTTTTCATTGCTTTTCGAA
AAGAAACACGATTTTTTAATTGGCCAGCTATAAATTCTGCAAGAATATTAGGATGCCCATACGGATTGGAAATTCGGGTAATAGCA
ATGTTGAGTTTTCTATTGGCACAATTAAGTTCTTTTTGAACATTCATCTGTAATTCTTCGATTCTTCGGGGTTTATCTTCAATTAA
TAATTTAGGAAATCCCATATAGATTATGATCTGAACGAGATCGATTCTTTTTTGAATTTCGATACGTGCAATTCCCTCCATACCAG
AGGATATTCTTATATTTTTTTGGACATAATTTTTAATACAGTCTCGTATTTTTTTATCTTCTTCTAAACCTTCAGAATACTTTTTT
GGTTGTGCAAACCAAATAGAATGATGACTTTGGGTTGTACCAAGTCTGAAACCAAGTGGATTTATTTTTTGTCCCATAGGCCTCCA
CTACTATATGTATCGTAACATGTTAGATTTATGTTTTCATTGCTGCATCCAGGTTTTTTAAAATACATTAAATATTCTTCATATTG
TTGATATAAGGATATATCTTCCAATACGATAGTTATATGACAAGTGGATCTTTTTATTGGGAAACTCCGTCCTCGTGCCCGAGGTT
TTAATTTTTTCACCGTATTTCCTTGATTCACTTCAGCTTTACTAATGACTAAATTGGTTTCTTTGAAACCCTTATTGTGACTAGCA
TTTGCTGCTGCAGAATAAACTAATTTAAAAATGGGATAACATCCTCGATACGGCATAAGTTCTAATATCATAAGTGCTTCTTCGTA
GGAACGTCCACGGATCTGATCAATAACTCTCCGTGCTTTGTGGGCAGACATAGATATATATTGCCCTAAAGCATATACGGAAGTAT
ATGATTTCTTCTTTTTCTTCTTTATCATAAGGTTTACCTCTCACTAAAAAAAAATTTATATTCATTATTCATTTTTTTTGAATTCA
TTTAATTAACGACGAGATCTATTATCATTTTTCGCGTGTCCTCGAAAATTTATAGTAGGTGAAAATTCTCCCAATTTATGTCCTAC
CATAAGGTCGATTATATAAACGGGTAAGTGTTCCCTTCCATTATGTATAGCGATAGTATGGCCAATCATTGTGGGTATAATAGTAG
ATGCCCGGGACCAAGTTATTATGATTTCTTTTTCCGCCTTTGTATTAAGCTTCTCTATTTTTCTTAATAAATGCTTTGCTACAAAA
GGATTTTTTTTTAGTGAACGTGTCACAGTTAATTAACTCCTATTTTTTTTTAAGACGAAGAAAGAAATTCTATTTTCTCTCCTATT
TACTACGGCGACGAAGAATCAAAGTCTCACTATATTTTTTCCTTTTTCTAGTTCTTCTTCCAAGCGCAGGATAACCCCAGGGGGTT
ACGGGTTTTTTTCTACCAATTGGAGCCCTCCCTTCACCACCTCCATGGGGGTGGTCGACAGGGTTCATAACTACTCCTCTTACTAC
AGGACGTTTACCTAGCCAACATTTCGATCCGGCTCTACCCAAACTTTTCTGGTTTACCCCAACATTTCCCACTTGTCCGACTGTTG
CTGAGCAGTTTTTGGATATCAAACGGACCTCTCCAGAAGGTAATTTTAATGTGGCCGATTTCCCCTCTTTTGCAATCAGTTTCGCT
ACAGCACCCGCTGCTCTAGCTAATTGTCCACCCTTTCCAAGTGTGATTTCTATATTATGTATGGCCGTGCCTAAGGGCATATCGGT
TGAAGTAGATTCTTCTTTTTGATCAATCAAAACCCCTTCCCAAACTGTACAAGCTTCTTCCAAAGCATACGGCTTTCTGAATGTAG
ATGATGATATCTATACGGATGGATCTTATATATATCGTAGAATTCTTCTATATATGGTAGAAGTACCACACGAGTGCATATATAGG
AATCAAAATCTGCCGAATAACTTATGTTATGATCTTCTACATACTAGGTCTTCCCGTTCCGTCATCTGGCTTATGTTCTTCATGTA
GCATTCAGACCGAATGACTCTATGAAATTACGTCGATACTTCCACATATTATGGGTAACGTAGGAGACATCTCTATTTTTCCCCGG
GGGAATCTTTAGAATTACCACTGCTTAGCTTTCAATTCGCCTCTGACCATCAAATGAAATGTGAATAACCCGTCCTCCTCTCTTTG
AAACAAGGGGCGCTTATGGTTCTGTCGGTGCTTGAAACAATTTTGTCTTCTCCATATTACTATATCTCTAGAGTCAATAATTTTAT
ATGAGGAACTACTGAACTCAATCACTTGCTGCCGTTACTCTTCAGTTTTCTGTTGAGGTCTATCCTGCAGAGGTACTCAAATTGGA
TCAGTGATCGATTTCTAGGTTTTGTCGTAAACCTAATTGGTTACTTCCAATTACGTAAATCAAATAGTTCAAACCGCACTCAAAGG
TAGGGCATTTCCCATTTTTATAGGAACTTCTGTACCAGAAACAATGGTATCTCCAATTATAGCCCCTCTGGGATGTAAAATATATC
TCTTCTCACCATCCCCATAGTGTATGAGACAAATGTATGCATTTCGATTAGGGTCGTATTCTATGGTTACGATTCTACCATATATG
TCTTTTGTATTTCGTCGAAAATCTATTTTACGGTATAGACGCTTATGACCTCCCCCTCTATGCCTTACGGTAATGATTCCTCTGGC
ATTACGACCTTTACCACAATGATGCTGCCCATAGATCAAATTATTTCGTGGATTGGATTTCACTTGACTGTCTACGGCTCCATTGC
GTGTGCTCGGGGTAGAAGTTTTGTATAAATGTATCGCCATGCTATTAAGTATTTTGATTTAAGTTCTTTTCTTTCTAAGAGGTGGA
ATAGAATAACCCGGTTGAAGCGTAATGATCATACGTCTGTAATGCATTGTATGTCCCAGAATAGGTCCCATTCTTTTAACCTTTCC
GGGGAGTCGATGACTATTCATAGCTATTACCTTGACACCAAAGAAGAGTTCGACCCAATGCTTTATTTCTGTCCTAGTTGATCCTG
ATTCGACATTAAAAGTATATTGATTTTTCCCCAATAACCGAATACTTTTGTCTGTAAATACTGCATATTTGATTCCATCCATAAAT
CGATTTTCTTCCCTATGAGTTCTAGTCTCAATAAGAATGCTAGTTCTTACTGTTCATATGTTATGATATGAATATACCACACCAAT
TCGTTATGTATAGATGATGAGAAGATTCCATTGATACAGAGCCAATTCCAATAGACTTATTGGAGGGTCCCATTGGCGTGCATCCA
GTAGGAATTGAACCTACGAATTCGCCAATTATGAGTTGGGCGCTTTAACCATTCAGCCATGGATGCTTAGTGGGGATCCTCGTACA
TGGTGAATAACCAAATTCCAATTGAAATGAAATCTTTAGGATAAATCAATGCAATTTAGGAGGAATCAATGAAAGGACATCAATTC
AAATCCTGGATTTTCGAATTGAGAGAAATAGTGAGAGAGATCAAGAATTCTCACTATTTCTTAGATTCATGGACCCAAATCAATTC
AGTGGGATCTTTCATTCATATTTTTTTCCACCAAGAACGTTTTAGAAAACTCTTGGACCCTCGAATTTTTAGTATCCTACTTTTGC
GCAATTCACAGGGTTCAACAAGCAATCGATATTTCACGATCAAGGGTGTACTACTATTTGTAGTAGCGGCCCTTCTATATCGTATT
AACAATCGAAATATGGTCGAAAGCAAAAATCTCTATTTGAAAGGGCTTCTTCCTATACCTATGAATTCCATTGGACCCAGAAATGA
TACATCGGAAGAATCTTTTGGGTCTTCCAATATCAATAGGTTGATTGTTTCGCTCCTGTATCTTACAAAAGGAAAAAAGATCTCTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ACY66292 ribosomal protein S3 [Brassica napus]11151e-118
NP_051096 ribosomal protein S3 [Arabidopsis thaliana]11033e-117
YP_001123237 ribosomal protein S3 [Arabis hirsuta]11024e-117
YP_001123588 ribosomal protein S3 [Draba nemorosa]11015e-117
YP_001123068 ribosomal protein S3 [Aethionema grandiflorum]11006e-117

Swiss-Prot top hits (Blast detail)Scoree value
P56798 30S ribosomal protein S3, chloroplastic11031e-118
A4QKN0 30S ribosomal protein S3, chloroplastic11031e-118
A4QLX1 30S ribosomal protein S3, chloroplastic11031e-118
A4QJW9 30S ribosomal protein S3, chloroplastic11031e-118
A4QK56 30S ribosomal protein S3, chloroplastic11022e-118

TrEMBL top hits (Blast detail)Scoree value
D1L8S6 30S ribosomal protein S3, chloroplastic11158e-119
B1A973 30S ribosomal protein S3, chloroplastic10476e-111
D3WEN8 30S ribosomal protein S3, chloroplastic10441e-110
D3WDB0 30S ribosomal protein S3, chloroplastic10404e-110
A5CB43 Putative uncharacterized protein10379e-110

Arabidopsis top hits (Blast detail)Scoree value
ATCG00800.1 encodes a chloroplast ribosomal protein S3, a constituent of the small subunit of the ribosomal complex11048e-120
ATCG00810.1 encodes a chloroplast ribosomal protein L22, a constituent of the large subunit of the ribosomal complex8117e-086
ATCG00830.1 encodes a chloroplast ribosomal protein L2, a constituent of the large subunit of the ribosomal complex7462e-078
ATCG00860.1 Encodes an unknown protein. This gene is regulated by AtSIG6 transcriptionally.7462e-078
ATCG01310.1 encodes a chloroplast ribosomal protein L2, a constituent of the large subunit of the ribosomal complex7462e-078

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
213  2%
 
1914  7%
 
935  19%
 
824  13%
 
629  15%
 
1119  10%
 
730  16%
 
1016  8%
 
1215  8%
 
202  1%
 
182  1%

Unigene MembersMember information