Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13509

FASTA Sequence
Unigene ID: UN13509Length: 727 SSRSNP
GGGTTTTCACAAGGCGTACAAAGGACAAACACGTAGCAGCAGCTCATTCCTCTCTCTCTCTCTATTTTCAAACCCTACGAGAGATC
TTCTTCGTCAAAAGAATCGAGCAATGAAAGGAGGTAAATCAAAGGCGGATACCAAGAGCTCTAAGCTCGCTGTGAACAAGAAGCCT
GCAAAGGCAAGCAAAGCGGCGGCTAAGGATCCTAACAAACCAAAGAGGCCTTCCAGTGCCTTCTTCGTTTTCATGGAGGATTTCCG
TCAGACTTACAAGAAGGATCATCCCAATAACAAATCTGTTGCTGCTGTTGGAAAAGCTGGTGGACAAAAGTGGAAATCCTTGTCTG
ACACTGAGAAGGCTCCCTACGTTGCTAAGGCTGACAACCGCAAAGTCGAGTATGAGAAGAACATGAAAGCCTACAACAAGAAGCTG
GAGGAAGGTCCAAAGGAGGACGAGGAGGAATCTGACAAGTCCGTGTCTGAGGTTAATGATGAGGATGATGCCGATGATGGGAGTGA
TGAGGAGGAAGACGATGACTAAGTTTAGTAGCATAATATAGGACGCTGCAAGGATCTCAAGCATGTTCTTTCTTGTTTTCTCTTAT
AATGTTAACGAAGTTGTTTTAAATGGTTTTTCTTTTCTTACTGATTCTACGTGTAATGGAAAAAGCGAGTGTAATGAGAGATTTGC
AGCTCAATATTAAACCATTTAGCTTTTTTTTTTTAAAAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAF80615 F2D10.18 [Arabidopsis thaliana]6362e-064
NP_564124 high mobility group B3 protein [Arabidopsis thaliana]6362e-064
BAJ33881 unnamed protein product [Thellungiella halophila]6344e-064
BAJ33706 unnamed protein product [Thellungiella halophila]6238e-063
XP_002890402 hypothetical protein ARALYDRAFT_472304 [Arabidopsis lyrata subsp. lyrata]6202e-062

Swiss-Prot top hits (Blast detail)Scoree value
P26585 HMG1/2-like protein5132e-051
P40619 HMG1/2-like protein4773e-047
P27347 DNA-binding protein MNB1B4263e-041
P40620 HMG1/2-like protein4146e-040
P40621 HMG1/2-like protein4146e-040

TrEMBL top hits (Blast detail)Scoree value
P93047 At1g20690/F2D10_156362e-064
Q9LM85 F2D10.186362e-064
A8MQS4 Uncharacterized protein At1g20696.36146e-062
O49596 HMG protein5993e-060
A8MQZ3 Uncharacterized protein At1g20693.35904e-059

Arabidopsis top hits (Blast detail)Scoree value
AT1G20696.1 HMGB3 (HIGH MOBILITY GROUP B 3); DNA binding / chromatin binding / structural constituent of chromatin / transcription factor6432e-067
AT1G20696.3 HMGB3 (HIGH MOBILITY GROUP B 3); DNA binding / chromatin binding / structural constituent of chromatin / transcription factor6144e-064
AT1G20693.1 HMGB2 (HIGH MOBILITY GROUP B 2); DNA binding / chromatin binding / structural constituent of chromatin / transcription factor6063e-063
AT1G20693.3 HMGB2 (HIGH MOBILITY GROUP B 2); DNA binding / chromatin binding / structural constituent of chromatin / transcription factor5965e-062
AT1G20693.2 HMGB2 (HIGH MOBILITY GROUP B 2); DNA binding / chromatin binding / structural constituent of chromatin / transcription factor5875e-061

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
114  12%
 
77  21%
 
122  6%
 
611  32%
 
85  15%
 
95  15%

Unigene MembersMember information