Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13522

FASTA Sequence
Unigene ID: UN13522Length: 1452 SSRSNP
GAGAGAGAGAGAGAGAGCGAGTTGAGAAAGAATGACATCGAGGTACTGGGTGGTGTCTCTACCAGTGAAGGACTCTTCTTCCACCT
TGTGGAATCGTCTACAGGAGCAGATCTCCAAGCATTCCTTTGACACTCCAGTTTATCGGTTCAACATTCCTAATCTTCGTGTTGGA
ACATTAGATTCTCTGCTCGCTCTCGGCGATGATCTGCTAAAGTCAAACAGCTTTGTGGAAGGAGTATCGCAGAAGATAAGGAGACA
GATCGAAGAGTTGGAGAGGATCTCTGGTGTGGAGAGCAACGCTCTTACTGTTGATGGAGTTCCTGTTGATTCTTATCTCACCAGGT
TTGTGTGGGATGAAGCTAAGTACCCAACAATGTCACCTCTCAAGGAGGTTGTGGACAACATTCAGTCTCAGGTTGCAAAGATTGAG
GATGATCTCAAGGTTCGTGTTGCTGAGTATAACAATGTCCGCGGTCAACTCAATGCCATTAACCGAAAGCAAAGTGGAAGTTTAGC
TGTTCGCGACCTCTCAAGCTTGGTTAAGCCAGAAGATATTGTCGCATCGGAACATCTCGAGACTCTCCTTGCAGTTGTTCCAAAGT
ATTCCCAAAAAGACTGGCTAGCATGCTATGAGACATTGACCGACTTTGTGGTTCCTAGGTCTTCGAAGAAATTGTTTGAGGATAAT
GAGTATGCTCTTTACACCGTCACTCTCTTCACTCGTGTTGCAGATAATTTCAGGACTAATGCGCGTGAGAAAGGGTTCCAAGTTCG
TGATTTTGAACATAGCGTTGAAGCACAAGAGACTCGTAAACAAGAGCTAGAGAAGCTGGTTCATGATCAGGAAAGTTTGAGAAGCT
CTCTTTTGCAGTGGTGCTACACCAGTTACGGAGAGGTTTTCAGCTCATGGATGCATTTCTGTGCTGTGCGTATATTCGCTGAGAGC
ATAATGAGATATGGTTTACCTCCGGCGTTCTTGGCATGTGTCTTATCTCCGGCTGTTAAAAGCGAGAAGAAAGTACGCTCCATTCT
TGAACGCTTGTGCGATTCTACTAACAGTTTATACTGGAAAAGCGAGGAGGATGCAGGAGCCATGGCTGGTTTAGCCGGTGACTCCG
AGACACATCCTTATGTCTCCTTCACGATCAACCTTGCTTAAAAAAGTTGATGAGAGATGCTTCTTCTACATCTCACACTTCATCTT
TTCTATTTGTTTATGTTCCATATATGTATTCCATTTTATTATTCGTGATTTGTTTTGATTATTCGAAATAAAAGTAAAGGTGGCAC
TCTAGAGAGACATGTGACTGTAGTTTTATTTTGGCCGGAGTCTTGTAGATTCCGATGAATTTCTGATACTTGTGGAAGAGGGAAGG
TTATACAGTATTGTTAAAACCTTTTGCCATGTTACTTGGATGCCTTGTTTATATTACGCAGATTCGTTTTCACTCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_563916 V-type proton ATPase subunit C [Arabidopsis thaliana]18544e-205
XP_002889973 de-etiolated 3 [Arabidopsis lyrata subsp. lyrata]18544e-205
ABH07428 vacuolar H+-ATPase subunit C [Gossypium hirsutum]16709e-184
XP_002512862 vacuolar ATP synthase subunit C, putative [Ricinus communis]16654e-183
XP_002275510 PREDICTED: hypothetical protein [Vitis vinifera]16512e-181

Swiss-Prot top hits (Blast detail)Scoree value
Q9SDS7 V-type proton ATPase subunit C18542e-206
Q9SCB9 V-type proton ATPase subunit C11472e-124
Q9U5N1 V-type proton ATPase subunit C7116e-074
Q7T385 V-type proton ATPase subunit C 1-A6982e-072
P21283 V-type proton ATPase subunit C 16946e-072

TrEMBL top hits (Blast detail)Scoree value
C0SUV0 Putative uncharacterized protein At1g12840 (Fragment)18543e-205
Q0PGG3 Vacuolar H+-ATPase subunit C16706e-184
B9RH03 Vacuolar ATP synthase subunit C, putative16652e-183
Q2HUJ7 V-ATPase subunit C15783e-173
C5YX05 Putative uncharacterized protein Sb09g03062015408e-169

Arabidopsis top hits (Blast detail)Scoree value
AT1G12840.1 DET3 (DE-ETIOLATED 3); proton-transporting ATPase, rotational mechanism18551e-207

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
112  10%
 
102  10%
 
123  15%
 
61  5%
 
74  20%
 
84  20%
 
94  20%

Unigene MembersMember information