Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13529

FASTA Sequence
Unigene ID: UN13529Length: 1121  SNP
GGAATCAAAACGTTAAGGAAAATCATGGGGAATGTGTCTGAAAGAAGCGTTGCATAAATTATCCAAAACTGACAAGTTTATACTGA
GAAAAGGTACAAATATATCAAAAACAAGAAGCTGAGGGACCAAACGAGTGTGAGAAGACACAAAGCATTGAAGAAACTAAAGCTTA
GAAGTCAAAACGATTGCTCAACTCTAACATTTCTTGAAAAACCTCTCTTAAGCTCCAATAATCTCAGTAGGTTCTTCGACCACAGT
CTCATCGGCCGGCCTGTCAACCTTCACACCAACATCCTCTGCTGTGTAGTCTCCATGAACCTCCATGAGCTTTCCGAGGTCGAATT
TGGGAGCCTTGAGGATCTTGACTTTACGGATGAAAACATTCTGAAGAGGGTAGATGCCCTGAGTTGCCTTCTCAATCTCCTTACCA
ATAGATTCTGGAATAAACTTGGCAACAAGCTCCTTGAGGTCAGAAGAGGAAGCTTCCTTGATCATAATCTCCCTCATCTTGCTGCG
AATCTGACGGATTTGGCTTGACTGAGCATAGCAAGTTCTCTTGACTTGGTTAGCACGTCTCTTGGTGAAAGCAATGCAGAACAGTC
TCAGAGTGTAGTTGTCGGTGGTTTTAACATCAACATGAGACTCAATCAAAGTCTGCCACTTTTTCACCAAGGATCTGAGTTTATCA
GTGGTGAAGTCCATGCCCCAGAACTGAGTCAAGACATTCCTTCCCTGAACATCTTCAGCTCTGAGACGGATCTTCCTGTAAGCGTT
ATCCTCATCATTTTGAAGATCAGCAAGAGACACCTCGAAAACTCTGTGTTTCAAACCCTCTGAAGCAATCTTGGTACCCTGAGTTC
TGGAAACAAGTGTCTTTCCGACATTTCTATGGGTGAAGTTAGAGGGAGCCTTGATGTCATACCAATCCTTCTTGGAGAAAGGATCA
ACAATCTTCTTCTTGCCTCCCTTTCTTCCTTTGGAGATTCGCTTGTTCTTCCCGACGGCCATGGCTGCTGAGTATAAGTTGGGGTC
GACGACGAAGCAGAAGCCCAGATATAGAACCTACGGCGCTTGTTGAATTTAAACCAGTATCTAGGGTTTTGAGTAGAGCATGTTGT
TCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_195193 40S ribosomal protein S3a-2 [Arabidopsis thaliana]12782e-138
XP_002882377 40S ribosomal protein S3A [Arabidopsis lyrata subsp. lyrata]12692e-137
XP_002869131 40S ribosomal protein S3A [Arabidopsis lyrata subsp. lyrata]12683e-137
NP_187135 40S ribosomal protein S3a-1 [Arabidopsis thaliana]12593e-136
XP_002512232 40S ribosomal protein S3a, putative [Ricinus communis]11742e-126

Swiss-Prot top hits (Blast detail)Scoree value
Q42262 40S ribosomal protein S3a-212788e-140
P49396 40S ribosomal protein S3a12672e-138
Q9CAV0 40S ribosomal protein S3a-112591e-137
Q8GTE3 40S ribosomal protein S3a11471e-124
A5B4K1 40S ribosomal protein S3a-111391e-123

TrEMBL top hits (Blast detail)Scoree value
B9RER3 40S ribosomal protein S3a, putative11741e-126
C6TI64 Putative uncharacterized protein11671e-125
C6TLV6 Putative uncharacterized protein11606e-125
C6TIB6 Putative uncharacterized protein11571e-124
C6TLT3 Putative uncharacterized protein11571e-124

Arabidopsis top hits (Blast detail)Scoree value
AT4G34670.1 40S ribosomal protein S3A (RPS3aB)12796e-141
AT3G04840.1 40S ribosomal protein S3A (RPS3aA)12609e-139

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  4%
 
67  28%
 
96  24%
 
116  24%
 
83  12%
 
122  8%

Unigene MembersMember information