Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13531

FASTA Sequence
Unigene ID: UN13531Length: 1568 SSRSNP
AATAGAAAGCTTTCGGTTTGATACAAAATAAAAGCTTTTGGTTTGATACAAAAAAAAAAAAAAAACACAAACATACCAAAAAATTG
AAAATTGACAAGAAAATAAAATACTCCATATGATATTAAAAATAAAAATGGTCACAAGAGAGAGAGATACGTTCTTAGAAAATTTC
AAGAGAAGGTAACAACAATAAATGCTGAAGAAAAGAGAGACGAAGAGTGTATCAAAACCAGATCAAAGAGGTGCCTTGCGAAACAA
GAAAGAGACCTTTCTTTCTCCCCTCAAAGCAGATCAGCAACGTTGGAAGGAAGCTCCTCAACAACAACGTTGTAAAACTTCTGGAT
ATCAAACAGCATCCTCTCATCATCCTTGGTCACAAAGTTGATCGCCACACCTTTCCTCCCGAACCTCCCACTCCTTCCAATACGGT
GAAGGTAGTTCTCAGGCTGAGTCGGCAAATCATAGTTGATGACCAAGGACACTTGCTGGACATCGATACCACGAGCCAAGAGGTCA
GTGGTGATGAGCACACGGGAGGAGCCGGACCTGAACTCCCTCATGATGATGTCTCTCGTGTTCTGGTCCATGTCTCCGTGAGTCGC
CGAGACAGTGTGGTCGCGACCTCTCATCTTGTCGGTGAGCCAGTCCACCTTCCTCCTGGTGTTCACGAAGATGACGCTCTGAGTGA
TGGCTAGAGTCTCGTAGAGGTCGCAGAGCGTCTCGAGCTTCCAGTCTTCCTTCTCAACGTTGACGTAGAACTGCTTGATACCTTCT
AGGGTGAGCTCGTCACGCTTCACCAGGATTCTCACTGGCTTGCTCATGAACTTCCTCGTGATCTCGAGAGCTTCTGGTGGCATTGT
TGCTGAGAAGACACCCACTTGGATCTTGGGTGGGAGAAGCTGGAAGATGTCATAGATCTGGTCTTTGAAACCACGGGAGAGCATCT
CATCAGCTTCATCAAGAACAAACATCTTGATGTTGTCGGCGCGGAGAGACTGCCTCTTGAGCATGTCGAACACGCGACCCGGAGTT
CCGACGACGACGTGGACACCGGCCTGGAGAATGCGCTGGTCCTCGCGGACGCTGGTTCCACCGACGCAGGCGTGGACCTTGACGCC
GAGGTAGTCGCCGAGGGCCCTCATGACCTTCTCGATCTGCTGGGCGAGCTCTCTGGTCGGGGCCAGGACGAGGGCCTGGCACTGGA
CGATGCTGAAGTCGAGCTGCTGGAGGACGCCGGAGCAGAAAGTGGCGGTTTTGCCGGTACCGGACTGGGCTTGTTGGATCACGTCG
AGGCCTTTGCAGAAAGGGACGATTCCTCTCTGCTGGATTGCAGATGGTTTCTCGAAACCATAAGCGTAGATACCCCTAAGGAGATT
CTCTTGGAGACCCATGGCGTCGAAGCTGTCGTGAACCTCATCGTAAGAGGTGAAGAACTCATCTTGTCCCTCAAGAACGTCGTTGA
GCTTCTGGTCGAACTGACGAGCATCAAACTGTGTGCCTTCTGGTGCGGATCCTGCCATGACTAAAAACACAGAACAACAACAACAA
CAGTTAGCCGCTATAAAAGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002884997 predicted protein [Arabidopsis lyrata subsp. lyrata]20777e-231
NP_566469 translational initiation factor 4A-1 [Arabidopsis thaliana]20769e-231
AAL91176 eukaryotic translation initiation factor [Arabidopsis thaliana]20732e-230
AAM63951 Eukaryotic initiation factor 4A, putative [Arabidopsis thaliana]20713e-230
BAE98559 eukaryotic protein synthesis initiation factor 4A [Arabidopsis thaliana]20661e-229

Swiss-Prot top hits (Blast detail)Scoree value
P41376 Eukaryotic initiation factor 4A-120764e-232
P41377 Eukaryotic initiation factor 4A-220352e-227
P41379 Eukaryotic initiation factor 4A-219941e-222
Q40467 Eukaryotic initiation factor 4A-1419903e-222
Q40465 Eukaryotic initiation factor 4A-1119895e-222

TrEMBL top hits (Blast detail)Scoree value
B9S5V7 Dead box ATP-dependent RNA helicase, putative19753e-219
A9P851 Predicted protein19735e-219
Q6T8C6 Initiation factor eIF4A-1519735e-219
A9PD17 Predicted protein19692e-218
A5BNE8 Putative uncharacterized protein19673e-218

Arabidopsis top hits (Blast detail)Scoree value
AT3G13920.1 EIF4A1 (EUKARYOTIC TRANSLATION INITIATION FACTOR 4A1); ATP-dependent helicase/ translation initiation factor20772e-233
AT1G54270.1 EIF4A-2; ATP-dependent helicase/ translation initiation factor20361e-228
AT3G13920.2 EIF4A1 (EUKARYOTIC TRANSLATION INITIATION FACTOR 4A1); ATP-dependent helicase/ translation initiation factor19662e-220
AT3G13920.3 EIF4A1 (EUKARYOTIC TRANSLATION INITIATION FACTOR 4A1); ATP-dependent helicase/ translation initiation factor19625e-220
AT1G72730.1 eukaryotic translation initiation factor 4A, putative / eIF-4A, putative19123e-214

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
82  8%
 
69  35%
 
111  4%
 
181  4%
 
219  35%
 
101  4%
 
71  4%
 
121  4%
 
191  4%

Unigene MembersMember information