Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13534

FASTA Sequence
Unigene ID: UN13534Length: 1547 SSR 
CACCAACTCAGAAGCGTCAGTTGGAGGAGTCCAAGAGAGGGGAGGAAGCCTGGCCCTTGACGACTGTCAAAGGATCGTGTAGCCTT
ACTCTCTATTTATAAAACCCTTAATTTGATCATCTTTCTCAAATCGAACATACTAATTCGACTGCTTCTCAATTAGATTCGGAAGA
AACTGATCATCCTCTCTCTCTCTGTCCAAATCGATAACGATGTCTCACTCTGCTGTTTCTCAGGCTGCTACTGCTGTCTCTGTTTC
AGTTGGCAACGAACGTTCTCTTAGAAGATCTGTCTTCAAGCATAACAATAGCATCAGCTTCAACACCAAGTCATCATGGTCATCTT
CCTTAGCGTTGAACCAGAAAACAACTACTACCATAAGAGATGCAAGACGGTACACGAGCACAACAACGTTATGCATGTCGGTTCAA
CAAGCAAGCAGCTCCAAAGTTTCCGTCTCTCCTATAGAGTTGGAAGACCCCAGTGATCCTCCTTTGAACTTGTACAAACCCAAAGA
TTCTTACACAGCTAAGATCGTCTCCGTGGAGCGAGTCGTCGGTCCAAAAGCTCCAGGAGAGACTTGTCACATCGTCATCGATCATG
ACGGTAACCTTCCTTACTGGGAAGGACAGAGTTACGGTGTCATCCCTCCCGGTGAGAACCCGAAGAAACCAGGAGCTCCACACAAT
GTGCGTCTTTACTCCATTGCATCAACGAGGTATGGAGACTTCTTTGACGGCAAAACAGCGAGTCTGTGTGTACGCAGAGCTGTTTA
TTACGACCCCGAGACTGGTAAAGAAGACCCTTCAAAGAACGGAGTCTGCAGCAACTTCTTATGCGATTCAAAACCTGGAGACAATA
TTCAAATCACAGGTCCATCGGGGAAGGTAATGCTATTACCAGAGAACGATCCAAACGCGACGCACATAATGATAGCAACGGGAACA
GGAGTTGCTCCGTACAGAGGCTACCTGCGTCGATTGTTCATGGAAGACGTCCCAAACTACGGATTTAAGGGGTTAGCTTGGCTCTT
CTTGGGAGTGGCTAACACTGACAGCCTTCTTTACGATGATGAGTTCAGCAAGTACTTGAAAGACCACCCGGATAACTTTAGGTTCG
ACAAGGCGTTGAGCAGAGAAGAGAAGAACAAGAAAGGTGGGAAGATGTACGTGCAGGACAAGATTGAAGAGTATAGCGATGAGATC
TTCAAGCTTTTGGATAACGGAGCTCATATTTACTTCTGTGGGCTCAAAGGAATGATGCCTGGGATTCAAGATACGCTTAAGAGAGT
TGCTGAGGAGAGAGGTGAGAGCTGGGAGGCCAAGCTTTTTCAGCTCAGGAAGAACAAGCAGTGGCACGTGGAAGTCTATTAAGCTT
CTTTACCTTTCTATTTTCACTTTGTTTTTTTTTTTGTTTTTGATTTGATTTTAAGCTTCTTAATAAAATAATTGAATTGCTGTGGT
TTGAGAAGAAATATTCTTCGGAATATTCTCAGAGAACGAACCATGTTATGACATGAGTCATCAAGAATAATCTTATCTTAGCTTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_849734 ferredoxin--NADP+ reductase [Arabidopsis thaliana]18374e-203
NP_564355 ferredoxin--NADP+ reductase [Arabidopsis thaliana]18213e-201
AAM65564 ferrodoxin NADP oxidoreductase, putative [Arabidopsis thaliana]18204e-201
XP_002893629 ATRFNR2 [Arabidopsis lyrata subsp. lyrata]18179e-201
NP_973942 ferredoxin--NADP+ reductase [Arabidopsis thaliana]16323e-179

Swiss-Prot top hits (Blast detail)Scoree value
Q9S9P8 Ferredoxin--NADP reductase, root isozyme 2, chloroplastic18372e-204
P41345 Ferredoxin--NADP reductase, root isozyme, chloroplastic15782e-174
Q41014 Ferredoxin--NADP reductase, root isozyme, chloroplastic15782e-174
O04397 Ferredoxin--NADP reductase, root-type isozyme, chloroplastic15486e-171
Q9M0V6 Ferredoxin--NADP reductase, root isozyme 1, chloroplastic15486e-171

TrEMBL top hits (Blast detail)Scoree value
C6TIM5 Putative uncharacterized protein16062e-176
B9SB31 Ferredoxin--NADP reductase15928e-175
A2XMM3 Putative uncharacterized protein15783e-173
Q10CF5 Ferredoxin-NADP reductase, root isozyme, chloroplast, putative, expressed15783e-173
C6T8Y4 Putative uncharacterized protein15651e-171

Arabidopsis top hits (Blast detail)Scoree value
AT1G30510.2 ATRFNR2 (ROOT FNR 2); FAD binding / NADP or NADPH binding / electron carrier/ ferredoxin-NADP+ reductase/ oxidoreductase18542e-207
AT1G30510.1 ATRFNR2 (ROOT FNR 2); FAD binding / NADP or NADPH binding / electron carrier/ ferredoxin-NADP+ reductase/ oxidoreductase18424e-206
AT1G30510.3 ATRFNR2 (ROOT FNR 2); FAD binding / NADP or NADPH binding / electron carrier/ ferredoxin-NADP+ reductase/ oxidoreductase16337e-182
AT4G05390.1 ATRFNR1 (ROOT FNR 1); FAD binding / NADP or NADPH binding / electron carrier/ ferredoxin-NADP+ reductase/ oxidoreductase15494e-172
AT5G66190.1 FNR1 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 1); NADPH dehydrogenase/ electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis/ electron transporter, transferring electrons within the noncyclic electron transp7762e-082

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
181  10%
 
83  30%
 
211  10%
 
202  20%
 
92  20%
 
61  10%

Unigene MembersMember information