Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13553

FASTA Sequence
Unigene ID: UN13553Length: 1455  SNP
AGGGGAAAAAGGAGAGGGAGGAGGTTTGGATCAGAAGAAAATGGAAATGGTGGAAGATATCGCTAAGAGATGGAAGGAATTGAGCG
GCAATAGCAAATGGAAAGACCTGCTTGATCCTCTTGACTTGGATCTACGCCGATACATCCTCCACTACGGCGACATGGTTCAAGTC
GGGTACATTACCTTCAATAGTGGCCGCCGGTCCAAATATGTAGGAGATAGCTTCTACACCAAGGAAGATCTCTTTGCTCGAACCGG
CTACCTTAAAGCCAACCCTTTCAGGTACGAGGTGACAAAGTACATATATGGAACATCGTCGATAAAGTTACCAGAATGTTTCATGA
TCAACTCATTGTCAAGGGAAGCATGGAACAAAGAGTCTAACTGGTTAGGTTATGTTGCGGTGGCTACTGACGAAGGCAAGGAGTTG
TTAGGGAGAAGAGACATTGTTGTAGCATGGCGAGGGACTATACAACCGTACGAGTGGGCTAACGATTTTGATTTCCCACTTGAATC
AGCTATCTCCGTATTCCCTCGAGCTGACCCGAGTGATCCACCTCGCATTGCTAGTGGTTGGCTGTCTCTTTATACAACCGCTGATC
CACGCTCACGTTTTGACAAGACCAGTGCACGAGAACAGGTTCAAGGAGAGCTCAAAAGGTTACTCGAATTGTACAAACATGAAGAA
GTTAGCATCACCTTAACAGGACATAGCTTGGGAGCAGTTCTCTCGATTCTGTCAGCCACAGACTTTCTCCATAACGAATGGCCAAA
GACCACACCAAGTCTTCAAGACAGGCTTTCTTGTGTCACGGTTTTCGCTTTCGGAAGCCCCCGCATCGGTGACCGCAACTTCAAAA
CACTCGTCGAGTCTCTCAAACAACTCAACATCTTGAGAGTAGCAAATGTCCCTGATCTCATCCCACATTACCCGCTGTTCAGGTTC
ACGGATGTTGGGGAGGAGCTCCATATCAACACACTGAAATCAGAGTACCTGAAACGGTCTCTTAACCTGGCACATTTCCACAACCT
GAAGGCCTACTTGCAAGGCGTGGCGGAGACACAACACAATCGATCAGAACTCAAGCTGGAGATTAACCGGGATATCGGGATGGTTA
AAAATGGTTTAGATGCTCTTGAAGATAAGTACTTAGTCCCTGGGGATTCGTGGGCTTTTGGGAACAAAGGAATGGTTAAAACTCAT
GACGGGACATGGATTCTCAATGGCGATATGGCAAAGGAGGACGTAAAAGAAGAAGAAGACGAATGTGTACCATGGATTTAGTAGCT
ACAATAAAATTAAATATTTACCTATTTTCAAAACAAGAACAATAAATAAAAAACAACAAAATCTGAGGCGCCAAATCTTGGATTAT
TCAATAGATGGAATTTGTGAATAGGGAAGTGGATTATTAATGTACAGTGAAACCTCTATAAATTAATAATGTTGGGACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
O82274 RecName: Full=Phospholipase A1-IIbeta17551e-193
AAM61647 lipase-like protein [Arabidopsis thaliana]13625e-148
NP_172115 alpha/beta-hydrolase-like protein [Arabidopsis thaliana]13553e-147
XP_002892328 predicted protein [Arabidopsis lyrata subsp. lyrata]12542e-135
XP_002881156 hypothetical protein ARALYDRAFT_320861 [Arabidopsis lyrata subsp. lyrata]12228e-132

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8LF19 Lipase-like protein13623e-148
Q9LNC2 F9P14.11 protein13552e-147
O82274 Putative lipase11681e-125
B9S985 Triacylglycerol lipase, putative10991e-117
B9I1N5 Predicted protein10919e-117

Arabidopsis top hits (Blast detail)Scoree value
AT2G31100.1 triacylglycerol lipase17555e-196
AT1G06250.1 lipase class 3 family protein13551e-149
AT4G18550.1 lipase class 3 family protein10252e-111
AT2G30550.1 lipase class 3 family protein5153e-052
AT2G30550.2 lipase class 3 family protein5153e-052

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
125  28%
 
91  6%
 
104  22%
 
62  11%
 
82  11%
 
112  11%
 
72  11%

Unigene MembersMember information