Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13562

FASTA Sequence
Unigene ID: UN13562Length: 1093  SNP
GGGCCTTAAAAAAGGCCAACTCGCAACTTTACTCTGGAACCCCAAGCGTAAAGATGCGGTCACTACTCTTGCCGCCGGCGAGCTCT
CCCGGCGTATTCGCCGTTGCGCTGCGGCCAGGTTTCCAACAACGCCTCTCAACCCGCCACCTGCCATTGTTCAATCCACTCGGCTT
GGCTCCAACCCAGCTTATCTCGCCGAAGAGGAGATCGACCATATCTTCTTACCAGTCTCCGTCCTCTCTACCCGTCTACGGTTTCC
AAATTCGAGGATCTAAACCTAGTTTCACGGTGGCTTTTTCCTCTCCCACGTCTCCTGCTTCAGTTTCGGCTGATAATGAAGTCGAC
AAGGCGAAACTCGCTCAGGTTGCAAAGAGACTAGAGAAGACTTCAAGGTACTTCAAGAGGCTTGGGAGTATTGGTTTCTGGGGGCA
GCTTGTGTCAACTGTTGTGGCTGCTGTCATTCTATCCTTTTCCATTGTTGTAACTGGGAAACCCACTTCACCTGCTACTTTCTACG
CTACCGCAACTGGCATCGCTGCTGCTTTTGTCTCTGTCTTCTGGTCCTTTGGTTATATTCGCCTCTCTGACAGGCTCCGTCGAACT
GCCGCTGACCCTGCCAAGGCCCCGCCTCGTGCAGATGTTGTGAAAGGGTTGAGAAGTGGGATTATGGTAAATCTTCTTGGAATGGG
AGCTGCAATTCTCGGGATGCAAGCAACGGTTGGGTTTTTAGTTGCAAAGGCTTTGACAACCTCAGCAAACCCTTTCTACCAAGGAG
TCTCTCAAGGATACAGTCCCGTTCTTGCTCTTGATGTCTTCCTCGTTCAGGCATCGGCGAACACCTTGCTTTCTCATTTTCTAGGC
CTTGTTTGTTCCTTAGAGCTGTTGCGGTCCGTGACAGTACCCAACTCCGAATCCGCCTTCGTTCCTAAAGTTGCATGAGTTTCTGC
CTTTTGTAGGCCTTAGCTCTTGTATTCATAAACGTTTGCCGCAGAGACTTATTTTCTTTTATAAATGAGAACCAACTGTTGTGGAC
TCAACCGCTTTATTACTGCCTAAGCACATGCTTCTTTGCCAGCAAGAAAATGTTGCAAGAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_565372 translocon at inner membrane of chloroplasts 21 [Arabidopsis thaliana]12575e-136
XP_002518684 conserved hypothetical protein [Ricinus communis]8642e-090
XP_002298747 predicted protein [Populus trichocarpa]8481e-088
ACU20954 unknown [Glycine max]8426e-088
ABK93915 unknown [Populus trichocarpa]8345e-087

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9SHU7 At2g15290/F27O10.612573e-136
B9RYA0 Putative uncharacterized protein8641e-090
B9GHE1 Predicted protein8489e-089
C6TGK2 Putative uncharacterized protein8424e-088
A9PC12 Putative uncharacterized protein8344e-087

Arabidopsis top hits (Blast detail)Scoree value
AT2G15290.1 TIC21 (TRANSLOCON AT INNER MEMBRANE OF CHLOROPLASTS 21); copper uptake transmembrane transporter/ iron ion transmembrane transporter/ protein homodimerization12581e-138

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
102  20%
 
61  10%
 
112  20%
 
92  20%
 
121  10%
 
81  10%
 
71  10%

Unigene MembersMember information