Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13564

FASTA Sequence
Unigene ID: UN13564Length: 1382  SNP
GGGACCGTGAATTGCTTAATATTGTCGTGGCGGCTGTGCCTATAAAAACTAAAGGTGGCAAGAATAAAAACGGACAACGCCATTTC
TCCTTCGTCTTCTGAATAGAGAGATAGAGATGGAGAATCACACGAAAGAGGGGCTGCAAGACCCAACCATGCAAGTTCCATCTCTT
AATTGCATCGATCTCGCCGACCATGATCTTCATCGTTCTGTTGCTTCCCTCAAACAGGCATGTTTGGATAGTGGATTTTTCTATGT
GATCAATCACGGTATAAACGAGGAGTTCATGGAGGATGTTTTCGAGCAGAGCAAGAAGTTTTTCGCTCTTCCTCTGGAGGAGAAGA
TGAAAGTTCTGAGAAACGAAAAGCACAGAGGCTATACACCTGTTCTTGATGAAATCTTAGATCCTGAGAATCAAGTTAACGGAGAT
CATAAAGAGGGTTATTACATTGGAATTGAAGTTCCAAAAGATGATCCTGATTATGATAAACCATTCTATGGTCCTAACCCTTGGCC
TGATTCTGATGTATTGCCTCAGTGGCGAGAGACCATGGAGAAATATCACCAAGAAGCATTGAGGGTTTCTAAGGATATTGGAAGAT
TATTGGCGTTAGCACTTGATCTGGATGCGAATTACTTTGATACCCCGGAGATGCTTGGAAAGCCTATTGCAACTATGCGATTGTTG
CATTATCAAGGGGTTTCTGACCCTTCGCAAGGAATATATGCTTGTGGAGCACATTCTGATTACGGAATGATGACTCTGCTAGCCAC
TGATGGTGTAATGGGCCTCCAGATATGCAAAGATAAGAACGCCAAGCCTCAGAAGTGGGAATATGTGCCGGCGATTAAAGGAGCAT
ATATTGTGAATCTTGGAGATATGCTGGAACGTTGGAGCAATGGCTTTTTCAAATCCACGCTACATCGGGTTCTTGGGAACGGTCAG
GAACGATATTCTATTCCATTTTTTGTTGAACCAAATCATGAATGTCTTGTGGAGTGTCTCCCAACCTGCAAGTCAGAAAGCAACGT
TCCCAAATATCCAGCGATCAAATGTTCGGCATACCTCACCCAACGTTACAAGGAAACACATGCAGAGTTAAGCATTTACAATCAAG
AAATATGAATGCTCTTGTCGATCAACACTACAACGGAAAGTAAACTGATAGTATGTCTTTAGATAAAGCTCAAAACGAAGCCTTAT
TACATGTTGTAACATAAGTTTTGAGTTTTTCTTACGGGCACAACTGCCCGCATTACACCCGCTTATGTCTTGTGTCAACCTTTTTA
TCCGTATCAAAGGAGAATAATAATTTACTGTCTATGTCTACTTGTAACCGAATATCTATCTATCTTCTATATGAATAAAGTAGCAG
TGTCTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002891163 oxidoreductase [Arabidopsis lyrata subsp. lyrata]15651e-171
NP_174753 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase-like protein [Arabidopsis thaliana]15491e-169
NP_190233 iron ion binding / oxidoreductase/ oxidoreductase protein [Arabidopsis thaliana]13275e-144
CBI28008 unnamed protein product [Vitis vinifera]13142e-142
XP_002283713 PREDICTED: hypothetical protein isoform 2 [Vitis vinifera]13142e-142

Swiss-Prot top hits (Blast detail)Scoree value
Q54RA4 Probable iron/ascorbate oxidoreductase DDB_G02832913362e-030
Q54243 Isopenicillin N synthase2359e-019
Q76NT9 1-aminocyclopropane-1-carboxylate oxidase1929e-014
A6BM06 1-aminocyclopropane-1-carboxylate oxidase1929e-014
Q7LL04 UPF0676 protein C1494.011686e-011

TrEMBL top hits (Blast detail)Scoree value
Q9C6F0 At1g3519015497e-170
B9RKI5 Hyoscyamine 6-dioxygenase, putative13122e-142
C5XM01 Putative uncharacterized protein Sb03g00324012971e-140
C0HHJ5 Putative uncharacterized protein12872e-139
B4FBV2 Iron ion binding protein12826e-139

Arabidopsis top hits (Blast detail)Scoree value
AT1G35190.1 oxidoreductase, 2OG-Fe(II) oxygenase family protein15494e-172
AT3G46490.1 iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors13272e-146
AT3G46500.1 oxidoreductase, 2OG-Fe(II) oxygenase family protein9491e-102
AT3G46480.1 iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors8811e-094
AT1G35190.2 oxidoreductase, 2OG-Fe(II) oxygenase family protein7823e-083

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  8%
 
82  15%
 
122  15%
 
105  38%
 
192  15%
 
111  8%

Unigene MembersMember information