Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13585

FASTA Sequence
Unigene ID: UN13585Length: 1193 SSRSNP
GGCTGATTAAAAAAAAGGAAGAGAGAAAGAGAGAGAGAGGATCAAAGATGGATCACGAAGCAGATGCATACCGTACGGATTTGATG
ACCATAACGAGGTTCGTGCTGAATGAGCAATCAAAGTACCCAGAGTCTCGTGGTGATTTCACCATTTTGCTCAGTAACATCGTTTT
GGGATGCAAATTCGTCTGCAGTGCTGTCAACAAGGCTGGTTTGGCCAAGCTAATTGGGCTTGCTGGGGAAACAAATATCCAGGGTG
AAGAGCAAAAGAAACTCGATGTGCTCTCTAATGATGTCTTTGTCAAAGCTTTGGTTAGCAGTGGCAGAACTTCTGTTCTTGTCTCA
GAAGAAGATGAGGAAGCAACGTTCGTGGAGTCATCCAAGCGTGGAAAGTACTGTGTTGTTTTTGATCCACTTGATGGATCCTCAAA
CATCGACTGTGGTGTTTCCATTGGAACCATCTTTGGGATTTACACAATGAGCCACAATGATGAGCCAACTACTGAAGATGTCTTGA
AACCTGGGAATGAAATGGTTGCTGCGGGTTACTGTATGTACGGAAGCTCCTGCATGCTTGTGTTGAGCACTGGAACTGGTGTCAAT
GGATTTACCCTGGACCCATCTCTAGGAGAGTTCATATTAACTCACCCGGACATTAAGATTCCGAAAAAGGGGAACATCTATTCAGT
GAATGAAGGCAATGCTCAGAACTGGGATGGTCCAACCACAAAGTATGTAGAGAAATGCAAGTTTCCTAAAGATGGTTCTCCCGCTA
AGTCTCTGAGATATGTGGGAAGTATGGTAGCTGATGTTCATCGCACACTGCTTTATGGAGGAATCTTCTTGTACCCGGCTGACAAG
AAAAGCCCCAATGGGAAACTGCGTGTTCTGTATGAAGTCTTCCCGATGTCGTTCTTGATGGAGCAAGCCGGAGGTCAGGCCTTCAC
TGGCAAGAAAAGGGCGCTAGACCTTGTGCCCGAGAAGATCCATGAGCGTTCTCCAATATTTCTTGGTAGCTACGAAGATGTAGAGG
AGATTAAGGCTCTGTATGCTGCAGAGGACTAAGATTCTCATTCTTCTTATTTTATTACTTGTCTCTCCCTTATTTCTATATCTTCT
TCTATTGAGACAAACAAACGACTCATTTATACAAGGGAGACTTTTTCTCATCTTTTTTCAACGCACCTAAGATAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAZ86538 fructose 1,6-bisphosphatase [Brassica rapa subsp. pekinensis]17154e-189
XP_002891265 hypothetical protein ARALYDRAFT_891347 [Arabidopsis lyrata subsp. lyrata]17012e-187
NP_175032 fructose-1,6-bisphosphatase, cytosolic [Arabidopsis thaliana]16903e-186
P46267 RecName: Full=Fructose-1,6-bisphosphatase, cytosolic; Short=FBPase; AltName: Full=D-fructose-1,6-bisphosphate 1-phosphohydrolase16771e-184
XP_002306693 predicted protein [Populus trichocarpa]15774e-173

Swiss-Prot top hits (Blast detail)Scoree value
Q9MA79 Fructose-1,6-bisphosphatase, cytosolic16901e-187
P46267 Fructose-1,6-bisphosphatase, cytosolic16775e-186
P14766 Fructose-1,6-bisphosphatase, cytosolic15476e-171
Q42649 Fructose-1,6-bisphosphatase, cytosolic15413e-170
Q9XF47 Fructose-1,6-bisphosphatase, cytosolic15413e-170

TrEMBL top hits (Blast detail)Scoree value
Q3Y479 Fructose 1,6-bisphosphatase17153e-189
A9PJM5 Putative uncharacterized protein15773e-173
B9H7R7 Predicted protein15773e-173
C6TM26 Putative uncharacterized protein15764e-173
C6TEQ3 Putative uncharacterized protein15739e-173

Arabidopsis top hits (Blast detail)Scoree value
AT1G43670.1 fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative16901e-188
AT5G64380.1 fructose-1,6-bisphosphatase family protein5905e-061
AT3G54050.1 fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative5341e-054
AT3G55800.1 SBPASE (sedoheptulose-bisphosphatase); phosphoric ester hydrolase/ sedoheptulose-bisphosphatase2276e-019

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
94  8%
 
85  10%
 
1110  19%
 
712  23%
 
127  13%
 
105  10%
 
193  6%
 
211  2%
 
64  8%
 
181  2%

Unigene MembersMember information