Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13642

FASTA Sequence
Unigene ID: UN13642Length: 1228  SNP
GAAAAGAAAAAGAAAAGAAAAAGACCAAACAGGAAAAGAAAGAATGTCAGACGTAGAACAAGAAGAAGAAACGTCAAGTGCTGTTA
GAGGTTCGTTAAGTTTCGATCTTCCCGAGGAAGTCCTTCAAGTCTTACCGTCCGATCCATTCGAGCAGCTGGATGTGGCCCGCAAA
ATCACATCCATTGCTCTCTCGACACGTGTCTCTGCTCTCGAATCAGAGTCGTCCGATCTCCGTGAGCTTCTCGCCGAGAAAGACAA
TCAAATCGCCGAGCTCCAATCACACGCGGAGTCTCTCGACGCGTCTCTCTCCGACGCGTTGCAAAAGCTTTCTCTCGCCGAAGATG
AAAAGGAGAATCTGGTCAGAGAGAACTCTTCGTTGTCGAGTACTGTCAGGAGACTCCAGAGAGATGTCTCTAAGCTTGAGGGTTTC
AGGAAGACGCTTATGATGTCTCTTCAAGACGACGACCAAAATGCAGGAACAACACAAATCATTGCTAAGCCAACACCAAACGATGA
AGATTCTCCATTTCAACCTTCAAGATATTCATCAATCCAGTCTCAAGCTTCTGAAGCTGTTGAACCAGCTCCAGTGGACAACGAAA
GCGAAGCTCCTAAACCGAGTTTATCGAACAGTGTTCCATTAGTATCTCAGACTGCTACGCCTCGGCTTACTCCTCCTGGTTCTCCA
CCAGCATTATCAGCTTCTAGTACCCCTAAAACGACTTCAAGACCTATCTCCCCTCGTCGCCATTCTGTATCCTTCTCTACTACTAG
AGGCATGTTTGATGATAATAGATCTTCTATCTCAATCTCAGAGCCTGGATCCCACACCGGACGAACTCGGGTTGATGGAAAAGAGT
TCTTCCGACAAGTCAGGAGCCGGTTATCTTACGAGCAGTTTGGTGCATTCCTTGGAAATGTGAAGGATCTTAACGCCCACAAGCAA
ACAAAAGATGAAACGCTTAGGAAAGCTGAAGAGATATTCGGAAGCGACAACAGAGATCTCTATGTCATATTCGAGGGCTTGATCAC
TCGCAACGCTCACTGAGAATTTGCATTCTTGTGTTATGCACGTTAAAAGTTATATACTCGGAACTCTTCAGACTCAAATTTCTTTC
GTTTTCTTGGCTGTCAAGTAAGACCAAGTGAACCGACAATTTGTTTTGTATCACCTGTTCATGTCGTGTATTTATATCTTTCTCAC
ATCTTCAATAAAACTACATTTCGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002870231 hypothetical protein ARALYDRAFT_915246 [Arabidopsis lyrata subsp. lyrata]14692e-160
NP_567470 uncharacterized protein [Arabidopsis thaliana]14502e-158
XP_002516832 conserved hypothetical protein [Ricinus communis]10963e-117
XP_002314437 predicted protein [Populus trichocarpa]10327e-110
CBI26144 unnamed protein product [Vitis vinifera]9862e-104

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q93W28 AT4g15540/dl3810w14502e-158
B9RSW3 Putative uncharacterized protein10962e-117
B9HYA4 Predicted protein10325e-110
B9FID6 Putative uncharacterized protein7914e-082
B6TU66 Putative uncharacterized protein7852e-081

Arabidopsis top hits (Blast detail)Scoree value
AT4G15545.1 unknown protein14517e-161
AT1G16520.1 unknown protein5842e-060
AT1G56080.1 unknown protein3055e-028

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  4%
 
61  4%
 
192  8%
 
1111  44%
 
83  12%
 
72  8%
 
92  8%
 
213  12%

Unigene MembersMember information