Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13644

FASTA Sequence
Unigene ID: UN13644Length: 830 SSRSNP
TTTTTTTTTAAATTAAAACTCTCAATTTCACTATATTCCCTAAAAAAAAAGAATTCATATTTGCTTTTCTAGAACTCAAATTATTT
TCAAGTTCTCTGTTTGATTATCGAGAAACATGACTATTGCTTTAACGATCGGAGGAAGTGGGTTCTCTGGTCTACCCGGATCTTCG
TTTTCCTCATCTTCTTCATCGCTCCGATTGAAGAACAGCAGACGAAAGGACACGAAGATGCTGAACAGGAAAGGAGTCATCTGTTC
TTCATCTTCTGTAATGGATCCGTATAAGACCCTTAGGATCCGACCCGATTCATCTGAGTACGAGGTCAAGCAAGCTTTCAGACAAC
TCGCCAAAAAGTATCATCCTGATGTTTGCAGAGGAAGCAACTGTGGAGTGCAGTTTCAGACAATCAACGAAGCTTACGATATTGTG
TTGAAGCAAATAAAGAATCAGATGGAGGGAACAGAGGAGTTTCAGCCATTCGATGTCTATGAAGAGGGATTCAACGGAATGAACGA
TCCAGATTGTGACACGTGGGAGGAATGGATGGGGTGGGAAGGTGCAGGAACCAGAGACTACTCCTCTCACGTGAATCCTTACGCGT
GAAGACGACGGTGACCGACTTGGCAATGATTGTATGCAGATAAATAACAACAGAGAGAGAGAGACTGTAAGATCAATGTAAATAGT
TGAAATTGTCTCTCTTGAATGGCTCTTAAATGTAAATAAAGTCATTTCTATGTTATGTAAACTCTCAAAGATTCAGTGATTAGCTT
AAAAGCTTTCCTGAATTTGGATCTAATGATAATAATTTGGATTCGAAGTTTGTTTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_178207 chaperone protein dnaJ 8 [Arabidopsis thaliana]8112e-084
ACF23035 ST240 [Eutrema halophilum]5413e-053
AAC72399 J8 [Arabidopsis thaliana]4903e-047
XP_002512737 Chaperone protein dnaJ 8, chloroplast precursor, putative [Ricinus communis]4591e-043
ACU18989 unknown [Glycine max]4519e-043

Swiss-Prot top hits (Blast detail)Scoree value
Q9SAG8 Chaperone protein dnaJ 8, chloroplastic8117e-086
O66921 Chaperone protein dnaJ 21442e-008
Q6KHF9 Chaperone protein dnaJ1423e-008
Q9KJT8 Chaperone protein dnaJ1396e-008
Q7NBW0 Chaperone protein dnaJ1333e-007

TrEMBL top hits (Blast detail)Scoree value
B4YYB8 ST240 (Fragment)5412e-053
B9RGM8 Chaperone protein dnaJ 8, chloroplast, putative4597e-044
C6TAY7 Putative uncharacterized protein4516e-043
B9GVM1 Predicted protein4472e-042
B9N9X0 Predicted protein4472e-042

Arabidopsis top hits (Blast detail)Scoree value
AT1G80920.1 J8; heat shock protein binding / unfolded protein binding8125e-087
AT3G05345.1 heat shock protein binding1404e-009
AT1G72070.1 DNAJ heat shock N-terminal domain-containing protein1361e-008
AT1G80030.1 DNAJ heat shock protein, putative1361e-008
AT1G80030.3 DNAJ heat shock protein, putative1361e-008

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
911  32%
 
72  6%
 
85  15%
 
63  9%
 
104  12%
 
112  6%
 
184  12%
 
193  9%

Unigene MembersMember information