Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13651

FASTA Sequence
Unigene ID: UN13651Length: 1033 SSRSNP
CGGGAAGCAATAGCAACTGAATTATATTTTGAAGTTGTAAATTGTATAATAAGATGCAGAATAGGTGTCTAATGCAAAAATAAAAT
AAAACTTTAACAGCAACCAAGTGTACAGACAGAAAATGCTAACGATGATGGCCTGTGTCTCGTATTTGATAAGAGTGAGACAGGTT
TGTTGAATAAGGAGTTGCTTTTGCTACTCCATATACAGTTACAGACTGAGATAAAAACTCATCACTATTGACCTTGTTTCTTGAAG
CTCAAATCTACATCTTCATTCATCGAATCAGCAACTTGTTTGGCTTTATCTTCGTTGAACCCGAGCGACTCCAAAATCTGGCGGCC
TGCTGAGTCCTTCTGAGACCAAACCCCAAGAAGCAAGTAGGCTGCTGTTAGTTCCCCATCCACACCAGATTTCTTCTTCTGGTCAA
CAGCCCAGTCAACGGCATTGCGAGCGGGTTCAGTAAGAGGAGGATGCTCAGGGCTGAAGAAGTACATATCTGATTTCCCTAGCAGC
TTTATAATCTCATCCCTCACCTTGAAAAGTGTGATACCATTCCCCCTCAGGAACTTAGCAGCTGTGCTTGTACCTTCGACCAAAAT
ACCCATGAGAATGGCCTCGGTCCCTGTAGTTGGATACTTGAGCTTCCTAGCCTCCAATTCCCCCATTGCCAGTGATTTTATCGCTC
TCGCCGACCATTTTGGGATCTTGTCCGAAGAACCATTCTCCGGTTGCGCAGTTGGGACGCTAAAGACGGTGCTGGCCGATGTCAAG
AACCGGTGCTTGGAGACGAAGAAGCGGCGGCGCGACGGTTGTTTCACCAGAAGCTTCTTACCTATCAGAGAAGGAGGAGGAATCAG
GGAAGAAGAGGGAGATGATGATGATGATGCACTCCGCCGGGGAACGACGACCGTCAAAGGGATAAAGGAAAGCGTGTACGACGACG
CCATTTTCACGAAACTCCGACAACAAGACAAAAAGCCTTTTTGGTTGAGCTTTAGCGATGATATTTTACTTACTCTGCTACTTGTG
T

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_567718 Double Clp-N motif protein [Arabidopsis thaliana]9143e-096
XP_002869676 clp amino terminal domain-containing protein [Arabidopsis lyrata subsp. lyrata]9116e-096
CAB45514 putative protein [Arabidopsis thaliana]8443e-088
ACU19852 unknown [Glycine max]6912e-070
CAN60931 hypothetical protein VITISV_006813 [Vitis vinifera]6884e-070

Swiss-Prot top hits (Blast detail)Scoree value
Q9TM05 ATP-dependent Clp protease ATP-binding subunit clpA homolog1702e-011
Q8EU05 Chaperone protein clpB1282e-006
P37571 Negative regulator of genetic competence clpC/mecB1254e-006

TrEMBL top hits (Blast detail)Scoree value
B6SHA3 ATP-dependent Clp protease ATP-binding subunit clpA9142e-096
Q93WL3 Putative uncharacterized protein9142e-096
Q9STK0 Putative uncharacterized protein AT4g253708442e-088
C6TDF0 Putative uncharacterized protein6911e-070
A5B483 Putative uncharacterized protein6883e-070

Arabidopsis top hits (Blast detail)Scoree value
AT4G25370.1 Clp amino terminal domain-containing protein9158e-099
AT4G12060.1 Clp amino terminal domain-containing protein5133e-052

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
102  7%
 
613  45%
 
75  17%
 
84  14%
 
124  14%
 
91  3%

Unigene MembersMember information