Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13653

FASTA Sequence
Unigene ID: UN13653Length: 1235 SSRSNP
TTTTTTTACTAAGGTCCCTGAAACCATATATATATATAATACATGATTTGTCCCGTTGACCTTTCCCCCCGGCAAGTCAATTATCT
CTTTGTCCCATTATCTATATCTCAGACACTCTTTCGGTCGTCATATTTCTTTGGGGCCTAAATTTTCAGTGTGTAAATGGGTATTT
TTCCTGAGTTTGGTGGCTGGATCAGTCAGAACACTCAACAGCCTAAAAAATCTGAAAATGTTAAATCCAAGCCTGTGAGAGAGAAA
AAAACTCACGATGAGAGAGATGAGACGAAGGAGCAATTAAAACTGTGGAGAGATGCAAATAAGAAGAAACAATATAATGAACCTTC
TCCTACGGTGAAGGTGCATACAGACCATAATATTGATAGCTTTTCCAGTGTGGACATGGACTTTACATTAGGATTGCCACCTCAAG
CAGCTTACGACCTTTTAATTAATCAAGACAACAAAACATACTCCAGAGAAATCAATGGCCGCCCACTTCTGAAAGCCATATCAAGA
AAAGTTACATCAGAGATAGGTATGGGGAATAGGCCGGTCCTGGAGGTTGAGAAAGAGTTGTCATGGAACTTCCTTTTCTTTTCAGG
AACTATCCCAATACGTCTAAATGTCCTCGAAGAGCCAAAAGAACTTGCTGCATATAACTGGAAAATGAGAAAAGGAATGGACTACA
TGGAAACGTTCAAGGTTAACTATAGAGTGGAGCCAATGTATGTTGATGCAGAACGCTTGTGCAAGCACAAGAAGCCGAAGAGTATA
GAAGAATACAGAAAATGTAGTGGTGGAAAAGGATTGATTGCGTCCAAGGTTAAAGTGGACCAGAATTTTAGGCCTTCTTTTCCTTG
GAATCTGCCACTGCTGTCTTGGTACTTTCGCCGGTTCACTGTTGCGACCACTAAGAAAGTGGTGGAAGATCTTCAAACGCGGGCTG
GCGATATCCGTCGGTTGTAAACGTCTTCGTAAAACAACACATCAAATAGTGTTTTAAAATCGCATTATCATAAATTCGAATAGCAG
AATTTTTTAAAATCTTGATATTTTTCACCAATAAGTACCGGGGAAAGATTTGCGCCTAGCGCAGGGGTGAAAGTGATGAACAAATT
TTCCTAAACATGATATTAATTATGTTACATCAATTATTTGCATCGGTAAATAAGAAATTTTACAACCCCGAAAAGGCAAAAAGATG
TAATATACTATATGGCGTAATATACGGTAGA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_173766 uncharacterized protein [Arabidopsis thaliana]6733e-068
NP_173773 uncharacterized protein [Arabidopsis thaliana]5551e-054
NP_973899 uncharacterized protein [Arabidopsis thaliana]5452e-053
XP_002893300 hypothetical protein ARALYDRAFT_472628 [Arabidopsis lyrata subsp. lyrata]5202e-050
NP_173781 uncharacterized protein [Arabidopsis thaliana]4897e-047

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9ZUE2 F28C11.156732e-068
Q9ZUD4 Expressed protein5551e-054
Q9ZUC8 F5O8.22 protein5451e-053
Q9ZUC6 Expressed protein4895e-047
Q9ZUD1 F5O8.19 protein4133e-038

Arabidopsis top hits (Blast detail)Scoree value
AT1G23520.1 unknown protein6892e-072
AT1G23600.1 unknown protein5556e-057
AT1G23670.2 unknown protein5466e-056
AT1G23690.1 unknown protein4893e-049
AT1G23660.1 unknown protein4444e-044

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
112  13%
 
83  20%
 
102  13%
 
61  7%
 
76  40%
 
91  7%

Unigene MembersMember information