Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13717

FASTA Sequence
Unigene ID: UN13717Length: 1367 SSRSNP
CCATAACAGTTTTTTTATTAATGTTTAGAATGATCATAGGGTAACCTATGGCCATGTCAAAACTGGAAAGACCAAGGAAAATAAAA
ACCAATCTCAAACTCAAATTCGTCCAGCATGACAGATTCACATGCAAATGCGTCTTTAGTTACAACACACTAAGTCTTTCATGATT
AAAAAAAAACCATAAATAAGTGAAGCAGAGATATGTCAATCACAGATTGATGCACTTTCCAAGTTTTTTCTGGAGTTCCTTTGTTT
CTTTCTCTGCTTTCTCCAGATTCTCTCTCAGCTTCTTTATCTCATCGCTCGACCGTTTCTGAGCTTCATTTGCCCTCTTCTCCGCT
TCAAGTCTTGCTGCTTGTTCTTCACCTAGCTGCTTCTCCAGCCTCTTTGCCGTTTCTCTCAGCTTTGTCTCCACCATATCTGTGAT
GCGATTAAGCTGTCGGTCATATGATATCTCTATTTGCTTCTTGAACTCAGATATCTCATCCTTTGAATAACCCTTGAGCGATTCAA
CCTCCTTCTTCTGGTCACGTACCTTGATAGCCTCTTCCTGAAGTTCATGAAACAATTCATCTGTAAACGGTTTTCCATTGTTCTTT
CTGGAGATGGAATCAACATGTGAGAGGAGCTTCTGAACTTGCGCAGCTTTCTTGCGCTTATCCTTAGTCTTGTTATCAAACAGTAC
CATTCGATTGTCACATAGCTCAAGCATCTCTTTCAGAAACTCAGGGCAAGCCTGAGCCAAATACTCCTCCAACGTCTCTTCATTCT
CTTCCAGCTCATCACCACCAGTGAACACAATGATCATATAATCAGCGATCTTACTACCAAACAGAGTTTGCAAGTGATAGAGAGCA
GATTTCTCCTCCTCGGAGAGCCGACCCCTCACAGAGAACACCAAAAGAACAGCATGGATCCCATCTTCAGCCAAAGTCATGCATCT
CACAATTTCTTTACAGATAAAAGCAGCTGCCATCGACACATCAAACAGACCAGGAGTGTCAACGACATTGATGACCTGGCCATCAT
CTTGAGTAACTCTATGTGACTCGCATGTGGTTGTCACTCCTAGAGTACTAACTCTCGACCTAAAGGCTTTTGTCCCAAGGATGCTG
TTCCCTGTTGCACTCTTTCCGTTTCCAGTACGGCCCACAAGAACTAGGGTTCGAGTAGGGTTTGAGGATGAAGCAAATTCCCAATC
ATCTTCCATCAAATCTCCACCCATCTTCAACAAACTCATATACCTTCTTGCTTGCAGAGAGAGGAACTAAAACTCAAAGACAGAAC
AGAACTAGAACTAATCAACAGATCAAAGACAAACGATGAGGTAAGAGAGAGAGAGAGGAGATTTACTTGTTGCTTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ34639 unnamed protein product [Thellungiella halophila]15874e-174
NP_564431 AIG1 domain-containing protein [Arabidopsis thaliana]14252e-155
XP_002893797 hypothetical protein ARALYDRAFT_473550 [Arabidopsis lyrata subsp. lyrata]14127e-154
AAG12538 Similar to AIG1 protein [Arabidopsis thaliana]14092e-153
AAN60299 unknown [Arabidopsis thaliana]14073e-153

Swiss-Prot top hits (Blast detail)Scoree value
P54120 Protein AIG17313e-076
O81025 Putative protein PHLOEM PROTEIN 2-LIKE A36481e-066
Q9NUV9 GTPase IMAP family member 43569e-033
Q8K3K9 GTPase IMAP family member 43504e-032
Q8NHV1 GTPase IMAP family member 73452e-031

TrEMBL top hits (Blast detail)Scoree value
Q9FE56 AIG1-like protein, 5' partial14143e-154
Q8H7C8 Putative uncharacterized protein14125e-154
Q9C8V3 AIG1-like protein, 5' partial; 1-1205 (Fragment)12011e-129
Q2V4J1 Putative uncharacterized protein At1g33970.311195e-120
B9R8X8 Aig1, putative11123e-119

Arabidopsis top hits (Blast detail)Scoree value
AT1G33970.1 avirulence-responsive protein, putative / avirulence induced gene protein, putative / AIG protein, putative14312e-158
AT1G33970.2 avirulence-responsive protein, putative / avirulence induced gene protein, putative / AIG protein, putative14312e-158
AT1G33970.4 avirulence-responsive protein, putative / avirulence induced gene protein, putative / AIG protein, putative14312e-158
AT1G33970.3 avirulence-responsive protein, putative / avirulence induced gene protein, putative / AIG protein, putative11193e-122
AT4G09940.1 avirulence-responsive family protein / avirulence induced gene (AIG1) family protein7752e-082

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
91  5%
 
118  40%
 
121  5%
 
62  10%
 
85  25%
 
103  15%

Unigene MembersMember information