Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13724

FASTA Sequence
Unigene ID: UN13724Length: 1816 SSRSNP
GGATGATGATCTTATTTAGCATTGGAAACCCTTTGTATTATTATGTGAAAGATTCCTCCGCCATGGCTGCTCCTTTTCTAAGCTCC
CCTCTTCAACTCACATCCACTTCTCCGATTCTCTTCACTAAAGTGCCTCCCACAAACCAAATCCAATTCAACCAGAGAACAACAAC
AACAACAACATGCACATCCTCCAACAGACTCCGTCTCCTCCTCCGCCGTTCCGCTGCGGCTGGTACCGCCGTGACGGATAAAGAAG
GAGGAGAGGATGTTCTGCTAAATCCCACGCCTGAGGAGGAGAAGCGTGAGGAGGAGGTGGTGGATTACGATTGGACAGAGGAGTGG
TACCCTCTGTACCTCACCAGAGACGTTCCCGACGATGCGCCGCTTGGTCTCACTGTCTTCGATCGCCAGATTGTGTTGTACAGAGA
CGGCGAAGGAACGCTTCGCTGTTACGAAGATCGGTGTCCACATCGGTTAGCTAAGTTGTCTGAAGGACAACTGATTGATGGGAGGT
TGGAATGTTTGTACCATGGTTGGCAATTTGAAGGAGATGGCAAATGCGTCAAGATACCTCAGCTTCCTGCGAGTGCCAAGATTCCA
AAGGTTGCTTGTGTGAAGACCTACGAGGTGAAGGACTCACAGGGAGTTGTGTGGGTTTGGATGTCGACGAAGACGCCTCCAGACCC
GGAAAAGCTTCCTTGGTTCGAGAATTTCGCTAGACCTGGTTTCTATGACATCTCGGGTGTTCACGAGCTACCTTACGATCATTCCA
TCCTTCTAGAGAATCTGATGGATCCGGCTCATGTCCCTATCTCTCATGACAGAACTGACTTCACTGCTAAAAGAGAAGATGCGCAG
CCGCTTGTCTTTGAGGTCACGGAGAGAACTAACCGTGGTTTCGCGGGGACTTGGGGACGGGAGAAAGAAGGCGGGAAAGGGAGTAA
TTTACTCCGGTTCAGTGCTCCATGTGTTCTGCAGAACAACCGAGAGTTTGAGGGAAAGGACGGGGTGAAGAACTACTTTTCAGGGC
TGTTTCTTTGTAGACCTACAGGACAAGGGAAGTCTATGCTTATAGTTAGGTTTGGTGTCACGAAAAGATCGCCTTTGGTTCAGGTG
TTACCTCTATGGTTCTGGCATCAGAATGCATGCAAGGTCTTTGAACAGGACATGGGGTTTCTATCGTCACAAAACGAGGTTTTGAT
GAAGGAGAAAGTACCAACAAAGGAGTTGTATCTTAACCTGAAGTCATCAGACACGTGGGTTGCTGAATATAGAAAGTGGATGGACA
AAGTTGGTCATGGGATGCCTTACCATTTCGGGCATAGGACAATCTCTCTCCCTAAGGTCCCTCCTGTGGTGGAACACGCCCCTGCG
GGACTCATTGCAGGTCTCTCGGCTTCTTATCCTGCAAAAGGTGGAGTTGGTACTATGCAGGCTCCCAATTTGGCTAACCGCTACTT
CAGACATGTGATCCATTGTAGAAGCTGCAGCAAAGTGATCAAATCTTTTGAACTCTGGAAAAATATCCTCTTTGGCACAGCCGTGG
CCTTGACGGCTTTGGCCATTCTGGTGGTTAGTAGGCAGTGGAAGGCTGTACTGTTAGGTTCAGCTGCGTTGTGCTCAGCTTCAGCT
TATGCTTGCTTAAGAGCTATACAAATGAACACCAATAACTTCATTAGAACACACAGAAGACTATGAAAATGTGTACCGGCATGGCA
TGTCTCTTCTTCCTACCAATTTGTATTTCTGTAAAATACTATTTTGCTTGTAATCATGAAGTTTATATGTTGCAAAAACTTGAGCC
ATTTCTTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_180055 translocon at the inner envelope membrane of chloroplasts 55-II [Arabidopsis thaliana]25473e-285
XP_002878803 hypothetical protein ARALYDRAFT_901077 [Arabidopsis lyrata subsp. lyrata]25348e-284
CAA04157 Rieske iron-sulfur protein Tic55 [Pisum sativum]20822e-231
XP_002515391 chlorophyll a oxygenase, putative [Ricinus communis]20572e-228
XP_002324928 predicted protein [Populus trichocarpa]20392e-226

Swiss-Prot top hits (Blast detail)Scoree value
Q9FYC2 Pheophorbide a oxygenase, chloroplastic4662e-045
Q9ZWM5 Chlorophyllide a oxygenase, chloroplastic2744e-023
Q9XJ38 Chlorophyllide a oxygenase, chloroplastic2719e-023
O05616 Vanillate O-demethylase oxygenase subunit2467e-020
Q8S7E1 Chlorophyllide a oxygenase, chloroplastic2144e-016

TrEMBL top hits (Blast detail)Scoree value
Q9SK50 Putative Rieske iron-sulfur protein25472e-285
O49931 Rieske iron-sulfur protein Tic5520821e-231
B9RNS2 Chlorophyll a oxygenase, putative20571e-228
B9IL92 Predicted protein20391e-226
B9HB88 Predicted protein20184e-224

Arabidopsis top hits (Blast detail)Scoree value
AT2G24820.1 TIC55 (TRANSLOCON AT THE INNER ENVELOPE MEMBRANE OF CHLOROPLASTS 55); 2 iron, 2 sulfur cluster binding / electron carrier/ oxidoreductase25747e-291
AT3G44880.1 ACD1 (ACCELERATED CELL DEATH 1); iron-sulfur cluster binding / pheophorbide a oxygenase4662e-046
AT4G25650.1 ACD1-LIKE (ACD1-LIKE); 2 iron, 2 sulfur cluster binding / electron carrier/ oxidoreductase4268e-042
AT4G25650.2 ACD1-LIKE (ACD1-LIKE); 2 iron, 2 sulfur cluster binding / electron carrier/ oxidoreductase3282e-030
AT1G44446.1 CH1 (CHLORINA 1); chlorophyllide a oxygenase2134e-017

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
87  22%
 
104  13%
 
118  25%
 
76  19%
 
123  9%
 
62  6%
 
92  6%

Unigene MembersMember information