Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13734

FASTA Sequence
Unigene ID: UN13734Length: 935  SNP
CATACAATAACCATATGTTTAATTCCATTATAAACCGTTGGTTACATCACAAACTTGGTGTTGTTACAAGGATTCTTAACATACAT
ACAATAACCACATGTCTTATTTCATATAAACCGTTGGTTACATCACAACTTTGGTATGATCACAAGCATTCTCCAACCATAATACA
AGATACAATTATTTCACATTTTAGAACAAAGGGAACATCCTCCAACGAGGCCTGAGATGACAGTTGGAGTTTGAATCATCATAAGC
CCTTTGAAACTTCACAGCAAAAGATTGATCATTGCTAAGAACCAAACGTCGCACTCCAAGATCATCGATCTCTAGACCCACGTTGA
TACACGAAACAGAGGAGATAACCGGACAATACATAAGCTTGTAAGCATCTCCATCTTCTTGAATCTGAAACAAGCTATTCCCTTTA
CCTTTCTCACCACCAATGCTCACAAAGCTCTTCCTCAGTTGCACGGAGTGGTTGATTCTCCACACTTTAGATTCAGGGCATAACCA
AACCGTGGAATCAAACTCGAGGCTGAGGCTAGTTGAGAGCTGGACATCCTTGGCTTTGGTGTTGAGCGGAGAGAAAGTTACTGGAA
GGCCTGAGAAAAAAGGAGATGATGACTGTACGATGTCAAGATTCAGACACGAGTCTTGTGTGTTTACATTTCGGCTTGAAGGGATA
AGACCACTTCCGGCTCCGATCTTAGCCGGTATTATGTAGTATTGGACATTGGACTGAACTGGATGTCCTGCTATGTCTACGACTGC
TTTGCCTGGTAGAGCATTGGCGGCAGAAGCTGCGGCCAAGACGGCTGAGAGAACGGTGAGAGTGGTTAAACAGAGAGTAAGCATCT
TCATTAGGTTAGAGTTTGTGGTGTGTCTTGTCTAGATAGCTTATCTTTTGTATGCGTATCTTTATGTAACAAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002888923 trypsin and protease inhibitor family protein [Arabidopsis lyrata subsp. lyrata]9251e-097
NP_565062 Kunitz family trypsin and protease inhibitor protein [Arabidopsis thaliana]8972e-094
NP_177476 drought-repressed 4 protein [Arabidopsis thaliana]2986e-025
XP_002888924 hypothetical protein ARALYDRAFT_895192 [Arabidopsis lyrata subsp. lyrata]2816e-023
ACL12055 Kunitz trypsin inhibitor [Nicotiana tabacum]2521e-019

Swiss-Prot top hits (Blast detail)Scoree value
P83667 Kunitz-type serine protease inhibitor DrTI1952e-014
P32765 21 kDa seed protein1738e-012
P83594 Factor Xa inhibitor BuXI1721e-011
P83595 Trypsin inhibitor BvTI1683e-011

TrEMBL top hits (Blast detail)Scoree value
Q9FX28 Tumor-related protein, putative8971e-094
Q39091 Dr4 protein2984e-025
B8Y888 Kunitz trypsin inhibitor2529e-020
Q8RXD5 Putative trypsin inhibitor2473e-019
Q9CAT9 Putative trypsin inhibitor; 19671-202972465e-019

Arabidopsis top hits (Blast detail)Scoree value
AT1G73325.1 trypsin and protease inhibitor family protein / Kunitz family protein8979e-097
AT1G73330.1 ATDR4; peptidase inhibitor2982e-027
AT1G73260.1 trypsin and protease inhibitor family protein / Kunitz family protein2472e-021

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
914  30%
 
710  22%
 
192  4%
 
122  4%
 
810  22%
 
115  11%
 
62  4%
 
101  2%

Unigene MembersMember information