Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13742

FASTA Sequence
Unigene ID: UN13742Length: 1659 SSR 
AGTTGATTTCGAACCCTAAGCTAAGGGGGTAAAGAGAGGTCTTTTCTCGGGAGACAAAACAGATAAACAGTGAGGGAGAAAGAAGG
ATGCAGAATCAGAGGCTGAAACAACAACAAGCAATGATGCAGCAAGCAATGATGCAGCAACAACATCACTCTCTCTATCATCCTAG
CCTCATGGCTCCTCCTCCTCCTCAGATGGAGCCTCTGCCAAGTGGAAACCTTCCTCCTGGTTTTGATCCCAGCACTTGCCGTAGTG
TGTATGCTGGAAACATCCATACGCAGGTCACTGAGGTTCTTCTTCAAGAGATTTTTGCTAGCACCGGCCCTGTTGAAAGCTGTAAA
CTCATCCGAAAGGATAAGTCATCATATGGATTTGTCCACTACTTTGATCAGAGATCTGCTGGTTTGGCTATCATGTCTCTTAACGG
AAGGCATCTATTTGGACAGCCTATCAAAGTTAATTGGGCGTATGCCACTGGTCAGAGGGAAGATACATCAAGCCATTTCAACATTT
TTGTTGGTGATCTCAGTCCAGAGGTTACTGATGCAGCACTGTTTGAGAGCTTTTCTGGCTTTAACACTTGCTCGGATGCAAGAGTG
ATGTGGGATCAGAAAACCGGACGCTCGAGAGGCTTTGGGTTTGTTTCCTTCCGCAATCAGCAGGATGCTCAAACTGCCATAAATGA
AATGAATGGTAAATGGATAAGTAGCAGACAAATCAGATGCAACTGGGCGACAAAGGGTGCTACTTTTGGGGAGGACAAACATAGCT
CTGATGGAAAAAGTGTCGTTGAACTTACAAACGGCTCAGAGGATGGTAGAGAGATCTCAATCTCAAACGAAGAAGCTCCTGAAAAC
AATCCTCAGTATACCACTGTGTATGTAGGAAACCTCGCTCCAGAAGTGACTCAGCTTGATCTACACCGCATGTTCCATGCACTTGG
CGCTGGAGTGATTGAAGAGGTTCGTGTCCAGCGAGACAAAGGCTTTGGTTTTGTGAGATATAACACTCATGACGAGGCTGCTCTTG
CTATTCAAATGGGCAACTCTCAGCCTTTCCTCTTTAGCAGACCCATAAAGTGTTCATGGGGAAGTAAACCAACACCAACAGGCACA
GCCTCAAACCCACTTCCACCACCAGCGCCGGTTCCAGTCCCTGGTTTGTCCCCAATGGACCTCTTAGCGTATGAGAGGCAACTGGC
TCTAGCCAAGATGCATCCTCAGGCTCAACATTCTCTGAGGCATGTAAATGCAGCTGGAGCAAGTGCAGCTATGTACGATGGTGGGT
TTCAGAATGTAGCTGCGGCGCATCAGCAGCTCATGTACTACCAGTAATATACTCTGGTCTCTTTGACCTGATGAGATGCTTTTTTC
TATCTATTTTTTTTTCTTTTTCTCTTCCTACTTAATTTATCACTTTCTTGCTTTTTTTCTAGACCTTTTTCAGAGTCTTATGTATG
TGTGTCTGTCATTTGAAGTCGTTGATTCTATATATGCTTAGAATGACATGAAATAAAAGGGATGTTTGTTTGGATTCCAAATTTGC
TTGGGTCCTAAACATGTTTGAGAAGGGTTTGTGGTTCTGTAGTAGTAGTGAACCTAATCGAAGTATTTTGACTTTAAATTCTTACG
GGTTAAATAAATTGAATTTTAATCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002894477 hypothetical protein ARALYDRAFT_474538 [Arabidopsis lyrata subsp. lyrata]19362e-214
NP_175810 oligouridylate-binding protein 1A [Arabidopsis thaliana]19325e-214
XP_002882868 hypothetical protein ARALYDRAFT_478823 [Arabidopsis lyrata subsp. lyrata]18188e-201
AAM65229 oligouridylate binding protein, putative [Arabidopsis thaliana]18142e-200
NP_188026 RNA recognition motif-containing protein [Arabidopsis thaliana]18062e-199

Swiss-Prot top hits (Blast detail)Scoree value
Q01085 Nucleolysin TIAR4366e-042
P70318 Nucleolysin TIAR3505e-032
P32588 Nuclear and cytoplasmic polyadenylated RNA-binding protein PUB13372e-030
P31483 Nucleolysin TIA-1 isoform p402512e-020
P52912 Nucleolysin TIA-12512e-020

TrEMBL top hits (Blast detail)Scoree value
Q9SYG4 At1g54080/F15I1_1619323e-214
Q8LAP3 Oligouridylate binding protein, putative18142e-200
Q9LJH8 AT3g14100/MAG2_518061e-199
B9ST80 Nucleolysin tia-1, putative17182e-189
A5AXF7 Putative uncharacterized protein16993e-187

Arabidopsis top hits (Blast detail)Scoree value
AT1G54080.1 oligouridylate-binding protein, putative19331e-216
AT1G54080.2 oligouridylate-binding protein, putative19187e-215
AT3G14100.1 oligouridylate-binding protein, putative18075e-202
AT1G17370.1 UBP1B (oligouridylate binding protein 1B); mRNA 3'-UTR binding16939e-189
AT1G17370.2 UBP1B (oligouridylate binding protein 1B); mRNA 3'-UTR binding16831e-187

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
69  39%
 
121  4%
 
211  4%
 
92  9%
 
102  9%
 
86  26%
 
112  9%

Unigene MembersMember information