Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN13752

FASTA Sequence
Unigene ID: UN13752Length: 770  SNP
GGACAGCAACGATCGCTCTTATTATAGACAAAAAAAAAAACGCTCTTCTTCTATCACTTTCAAAGACGGAATCCCGACAAGAATCC
GGTGATCGAAACTTCGAAACTCACAAAGGAGTAAATCGTAAAAGATGCATTCTTTTGGATACAGAGCAAACGCTCTGCTCACGTTC
TCCCTCACTGCCCTCGCGTTCATCTGCGCAATCGCGTCTTTCTCAGACAATTTCAGCAACCAGAATCCCTCTGCTGAGATCCAGAT
AGTTAACATCAATCGGTTTAAGAAGCAATCGTATGGAAACGATGAGGTCAGTTTGACATTGGACATAACTGCAGACTTGCAGTCAC
TTTTTACTTGGAACACTAAACAGGTTTTCGCTTTCGTGGCAGCAGAATACGAAACCCCAAAGAACTCCCTGAATCAGGTTTCTCTA
TGGGATGCGATTATCCCTGATAAAGAACACGCCAAGTTCCGGGTTCAAACCTCAAACAAGTACCGTTTCATTGATCAGGGACATAA
CCTTCGTGGAAAAGAGTTCAACTTGACGTTACACTGGCATGTCATGCCCAAGACCGGCAAGATGTTTGCTGACAAGATTGTCATGC
CTGGTTACAGTTTGCCAGATGCATACAAATGATGAAGATTGAAGATTACTTCTAAGAGTTTTTTTTTTGTATTTCGTTTTTTTCTT
TTCATGGAAAAGATTCAGTCTTCCTTTTATTCTGTGAACTAGAAAAGTAATCTCAAAGGTACTATTGATCTCTTCTTAATTA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002882405 signal peptidase subunit family protein [Arabidopsis lyrata subsp. lyrata]8211e-085
NP_566250 Signal peptidase complex subunit 3A [Arabidopsis thaliana]8155e-085
NP_198095 Signal peptidase complex subunit 3B [Arabidopsis thaliana]7797e-081
XP_002874372 signal peptidase subunit family protein [Arabidopsis lyrata subsp. lyrata]7691e-079
XP_002512352 microsomal signal peptidase 23 kD subunit, putative [Ricinus communis]7242e-074

Swiss-Prot top hits (Blast detail)Scoree value
Q9MA96 Signal peptidase complex subunit 3A8152e-086
Q53YF3 Signal peptidase complex subunit 3B7793e-082
Q9LGB4 Probable signal peptidase complex subunit 32865e-025
P28687 Signal peptidase complex subunit 32481e-020
B0G180 Signal peptidase complex subunit 32462e-020

TrEMBL top hits (Blast detail)Scoree value
B9RF33 Microsomal signal peptidase 23 kD subunit, putative7241e-074
B9INH2 Predicted protein7151e-073
C6SWM6 Putative uncharacterized protein7061e-072
B9MZT3 Predicted protein7042e-072
C6T085 Putative uncharacterized protein6999e-072

Arabidopsis top hits (Blast detail)Scoree value
AT3G05230.1 signal peptidase subunit family protein8162e-087
AT5G27430.1 signal peptidase subunit family protein7802e-083
AT3G05230.2 signal peptidase subunit family protein6021e-062

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
112  11%
 
67  39%
 
123  17%
 
92  11%
 
82  11%
 
71  6%
 
101  6%

Unigene MembersMember information